DNA duplexes and triplex-forming oligodeoxynucleotides incorporating modified nucleosides forming stable and selective triplexes

We have previously reported DNA triplexes containing the unnatural base triad G-PPI·C3, in which PPI is an indole-fused cytosine derivative incorporated into DNA duplexes and C3 is an abasic site in triplex-forming oligonucleotides (TFOs) introduced by a propylene linker. In this study, we developed a new unnatural base triad A-ψ·C(R1) where ψ and C(R1) are base moieties 2'-deoxypseudouridine and 5-substituted deoxycytidine, respectively. We examined several electron-withdrawing substituents for R1 and found that 5-bromocytosine (C(Br)) could selectively recognize ψ. In addition, we developed a new PPI derivative, PPI(Me), having a methyl group on the indole ring in order to achieve selective triplex formation between DNA duplexes incorporating various Watson-Crick base pairs, such as T-A, C-G, A-ψ, and G-PPI(Me), and TFOs containing T, C, C(Br), and C3. We studied the selective triplex formation between these duplexes and TFOs using UV-melting and gel mobility shift assays.     

Electron attachment induced proton transfer in a DNA nucleoside pair: 2'-deoxyguanosine-2'-deoxycytidine

To elucidate electron attachment induced damage in the DNA double helix, electron attachment to the 2'-deoxyribonucleoside pair dG:dC has been studied with the reliably calibrated B3LYP/DZP++ theoretical approach. The exploration of the potential energy surface of the neutral and anionic dG:dC pairs predicts a positive electron affinity for dG:dC [0.83 eV for adiabatic electron affinity (EAad) and 0.16 eV for vertical electron affinity (VEA)]. The substantial increases in the electron affinity of dG:dC (by 0.50 eV for EAad and 0.23 eV for VEA) compared to those of the dC nucleoside suggest that electron attachment to DNA double helices should be energetically favored with respect to the single strands. Most importantly, electron attachment to the dC moiety in the dG:dC pair is found to be able to trigger the proton transfer in the dG:dC- pair, surprisingly resulting in the lower energy distonic anionic complex d(G-H)-:d(C+H).. The negative charge for the latter system is located on the base of dC in the dG:dC- pair, while it is transferred to d(G-H) in d(G-H)-:d(C+H)., accompanied by the proton transfer from N1(dG) to N3(dC). The low energy barrier (2.4 kcal/mol) for proton transfer from dG to dC- suggests that the distonic d(G-H)-:d(C+H). pair should be one of the important intermediates in the process of electron attachment to DNA double helices. The formation of the neutral nucleoside radical d(C+H). is predicted to be the direct result of electron attachment to the DNA double helices. Since the neutral radical d(C+H). nucleotide is the key element in the formation of this DNA lesion, electron attachment might be one of the important factors that trigger the formation of abasic sites in DNA double helices.     

pH‐Independent Recognition of the dG ⋅ dC Base Pair in Triplex DNA: 9‐Deazaguanine N7‐(2′‐Deoxyribonucleoside) and Halogenated Derivatives Replacing Protonated dC

Triplex-forming oligonucleotides (TFOs) containing 9-deazaguanine N⁷-(2′-deoxyribonucleoside) 1a and halogenated derivatives 1b,c were synthesized employing solid-phase oligonucleotide synthesis. For that purpose, the phosphoramidite building blocks 5a – c and 8a – c were synthesized. Multiple incorporations of 1a – c in place of dC were performed within TFOs, which involved the sequence of five consecutive 1a – c ⋅ dG ⋅ dC triplets as well as of three alternating 1a – c ⋅ dG ⋅ dC and dT ⋅ dA ⋅ dT triplets. These TFOs were designed to bind in a parallel orientation to the target duplex. Triplex forming properties of these oligonucleotides containing 1a – c in the presence of Na⁺ and Mg²⁺ were studied by UV/melting-curve analysis and confirmed by circular-dichroism (CD) spectroscopy. The oligonucleotides containing 1a in the place of dC formed stable triplexes at physiological pH in the case of sequence of five consecutive 1a ⋅ dG ⋅ dC triplets as well as three alternating 1a – c ⋅ dG ⋅ dC and dT ⋅ dA ⋅ dT triplets. The replacement of 1a by 9-halogenated derivatives 1b,c further enhanced the stability of DNA triplexes. Nucleosides 1a – c also stabilized duplex DNA.     

Analysis of an Active Deformylation Mechanism of 5‐Formyl‐deoxycytidine (fdC) in Stem Cells

The removal of 5‐methyl‐deoxycytidine (mdC) from promoter elements is associated with reactivation of the silenced corresponding genes. It takes place through an active demethylation process involving the oxidation of mdC to 5‐hydroxymethyl‐deoxycytidine (hmdC) and further on to 5‐formyl‐deoxycytidine (fdC) and 5‐carboxy‐deoxycytidine (cadC) with the help of α‐ketoglutarate‐dependent Tet oxygenases. The next step can occur through the action of a glycosylase (TDG), which cleaves fdC out of the genome for replacement by dC. A second pathway is proposed to involve C?C bond cleavage that converts fdC directly into dC. A 6‐aza‐5‐formyl‐deoxycytidine (a‐fdC) probe molecule was synthesized and fed to various somatic cell lines and induced mouse embryonic stem cells, together with a 2′‐fluorinated fdC analogue (F‐fdC). While deformylation of F‐fdC was clearly observed in vivo, it did not occur with a‐fdC, thus suggesting that the C?C bond‐cleaving deformylation is initiated by nucleophilic activation.     

Synthesis of a DNA Promoter Segment Containing All Four Epigenetic Nucleosides: 5‐Methyl‐, 5‐Hydroxymethyl‐, 5‐Formyl‐, and 5‐Carboxy‐2′‐Deoxycytidine

A 5‐formyl‐2′‐deoxycytidine (fdC) phosphoramidite building block that enables the synthesis of fdC‐containing DNA with excellent purity and yield has been developed. In combination with phosphoramidites for 5‐methyl‐dC, 5‐hydroxymethyl‐dC, and carboxy‐dC, it was possible to prepare a segment of the OCT‐4 promoter that contains all four epigenetic bases. Because of the enormous interest in these new epigenetic bases, the ability to insert all four of them into DNA should be of great value for the scientific community.     

Investigation of multiple binding sites on ribonuclease A using nano-electrospray ionization mass spectrometry

Multiple non-active site interactions between ribonuclease A (RNAse) and selected target molecules were investigated using nano-electrospray ionization mass spectrometry (nano-ESI-MS). Among the building blocks of RNA, phosphate and ribose showed such multiple interactions. Multiple phosphate interactions survived a high cone voltage, while multiple interactions with D-ribose disappeared already at a low cone voltage. Using nano-ESI-MS, only cytosine among the individual bases appeared to interact with RNAse. Interestingly, guanosine binds to the RNAse surface at high cone voltage, probably as a result of cooperative binding of the sugar and the guanine base. Upon binding of deoxycytidine oligonucleotides with six (dC6), nine (dC9) and twelve (dC12) deoxycytidine nucleotide units to RNAse, the dC12 unit showed the strongest interaction. Upon collision-induced dissociation (CID) of the RNAse/dC6 complex, this complex survived dissociation at an energy level where covalently bound cytosine from dC6 was lost. This is in contrast to CID of RNAse complexed with mononucleotide cytidine 2'-monophosphate (CMP), which dissociates from the protein without breaking of covalent bonds.     

Fourier transform infrared spectroscopy of 2'-deoxycytidine aggregates in CDCl3 solutions

We investigated the self-aggregation of 2'-deoxy-3',5'-bis(tert-butyldimethylsilyl)-cytidine dC(TBDMS)(2) in CDCl(3) solutions by Fourier transform infrared (FT-IR) spectroscopy and report the formation of larger aggregates than dimers in this solvent for the first time. The hydrogen bonding patterns in these complexes, which occur with increasing concentration may serve as a model for DNA super-structures such as triplexes. From the IR spectra, wavelength dependent absolute extinction coefficients of the monomer, dimer as well as a contribution from larger clusters which are supposedly trimers are deduced on the basis of a simple deconvolution method. Our results are supported by RI-B3LYP/TZVP calculations within the conductorlike screening model framework, to account for solvent effects in the ab initio calculations.     

Electron Attachment to Hydrated Oligonucleotide Dimers: Guanylyl‐3′,5′‐Cytidine and Cytidylyl‐3′,5′‐Guanosine

The dinucleoside phosphate deoxycytidylyl‐3′,5′‐deoxyguanosine (dCpdG) and deoxyguanylyl‐3′,5′‐deoxycytidine (dGpdC) systems are among the largest to be studied by reliable theoretical methods. Exploring electron attachment to these subunits of DNA single strands provides significant progress toward definitive predictions of the electron affinities of DNA single strands. The adiabatic electron affinities of the oligonucleotides are found to be sequence dependent. Deoxycytidine (dC) on the 5′ end, dCpdG, has larger adiabatic electron affinity (AEA, 0.90 eV) than dC on the 3′ end of the oligomer (dGpdC, 0.66 eV). The geometric features, molecular orbital analyses, and charge distribution studies for the radical anions of the cytidine‐containing oligonucleotides demonstrate that the excess electron in these anionic systems is dominantly located on the cytosine nucleobase moiety. The π‐stacking interaction between nucleobases G and C seems unlikely to improve the electron‐capturing ability of the oligonucleotide dimers. The influence of the neighboring base on the electron‐capturing ability of cytosine should be attributed to the intensified proton accepting–donating interaction between the bases. The present investigation demonstrates that the vertical detachment energies (VDEs) of the radical anions of the oligonucleotides dGpdC and dCpdG are significantly larger than those of the corresponding nucleotides. Consequently, reactions with low activation barriers, such as those for O? C σ bond and N‐glycosidic bond breakage, might be expected for the radical anions of the guanosine–cytosine mixed oligonucleotides.     

pH-Independent triplex formation: hairpin DNA containing isoguanine or 9-deaza-9-propynylguanine in place of protonated cytosine

Triplex-forming oligonucleotides (TFOs) containing 2'-deoxyisoguanosine (2), 7-bromo-7-deaza-2'-deoxyisoguanosine (2) as well as the propynylated 9-deazaguanine N7-(2'-deoxyribonucleoside) were prepared. For this the phosphoramidites 9a, b of the nucleoside 1 and, the phosphoramidites 19, 20 of compound 3b were synthesized. They were employed in solid-phase oligonucleotide synthesis to yield the protected 31-mer oligonucleotides. The deblocking of the allyl-protected oligonucleotides containing 1 was carried out by Pd(0)[PPh3]4-PPh3 followed by 25% aq. NH3. Formation of the 31-mer single-stranded intramolecular triplexes was studied by UV-melting curve analysis. In the single-stranded 31-mer oligonucleotides the protonated dC in the dCH(+)-dG-dC base triad was replaced by 2'-deoxyisoguanosine (1), 7-bromo-7-deaza-2'-deoxyisoguanosine (2) and, 9-deaza-9-propynylguanine N7-(2'-deoxyribonucleoside) (3b). The replacement of protonated dC by compounds 1 and 3b resulted in intramolecular triplexes which are formed pH-independently and are stable under neutral conditions. These triplexes contain "purine" nucleosides in the third pyrimidine rich strand of the oligonucleotide hairpin.     

Optimization of non-natural nucleotides for selective incorporation opposite damaged DNA

The promutagenic process known as translesion DNA synthesis reflects the ability of a DNA polymerase to misinsert a nucleotide opposite a damaged DNA template. To study the underlying mechanism of nucleotide selection during this process, we quantified the incorporation of various non-natural nucleotide analogs opposite an abasic site, a non-templating DNA lesion. Our kinetic studies using the bacteriophage T4 DNA polymerase reveal that the pi-electron surface area of the incoming nucleotide substantially contributes to the efficiency of incorporation opposite an abasic site. A remaining question is whether the selective insertion of these non-hydrogen-bonding analogs can be achieved through optimization of shape and pi-electron density. In this report, we describe the synthesis and kinetic characterization of four novel nucleotide analogs, 5-cyanoindolyl-2'-deoxyriboside 5'-triphosphate (5-CyITP), 5-ethyleneindolyl-2'-deoxyriboside 5'-triphosphate (5-EyITP), 5-methylindolyl-2'-deoxyriboside 5'-triphosphate (5-MeITP), and 5-ethylindolyl-2'-deoxyriboside 5'-triphosphate (5-EtITP). Kinetic analyses indicate that the overall catalytic efficiencies of all four nucleotides are related to their base-stacking properties. In fact, the catalytic efficiency for nucleotide incorporation opposite an abasic site displays a parabolic trend in the overall pi-electron surface area of the non-natural nucleotide. In addition, each non-natural nucleotide is incorporated opposite templating DNA approximately 100-fold worse than opposite an abasic site. These data indicate that selectivity for incorporation opposite damaged DNA can be achieved through optimization of the base-stacking properties of the incoming nucleotide.     

Competitive Assay for Theophylline Based on an Abasic Site‐Containing DNA Duplex Aptamer and a Fluorescent Ligand

A fluorescence assay for theophylline, one of the common drugs for acute and chronic asthmatic conditions, has been developed based on an abasic site‐containing DNA duplex aptamer (AP aptamer) in combination with an abasic site‐binding fluorescent ligand, riboflavin. The assay is based on the competitive binding of theophylline and riboflavin at the abasic (AP) site of the AP aptamer. In the absence of theophylline, riboflavin binds to the receptor nucleotide opposite the AP site, which leads to fluorescence quenching of the riboflavin. Upon addition of theophylline, competitive binding occurs between theophylline and riboflavin, which results in an effective fluorescence restoration due to release of riboflavin from the AP site. From an examination of the optimization of the AP aptamers, the complex of riboflavin with a 23‐mer AP aptamer (5′‐TCT GCG TCC AGX GCA ACG CAC AC‐3′/5′‐GTG TGC GTT GCC CTG GAC GCA GA‐3′; X : the AP site (Spacer C3, a propylene residue)) possessing cytosine as a receptor nucleotide was found to show a selective and effective fluorescence response to theophylline; the limit of detection for theophylline was 1.1 μM . Furthermore, fluorescence detection of theophylline was successfully demonstrated with high selectivity in serum samples by using the optimized AP aptamer and riboflavin.     

Dipyrido[3,2-a:2′,3′-c]phenazine-Tethered Oligo-DNA: Synthesis and Thermal Stability of Their DNA⋅DNA and DNA⋅RNA Duplexes and DNA⋅DNA⋅DNA Triplexes

Dipyrido[3,2-a:2′,3′-c]phenazine (dppz) derivatives were conjugated to 9-mer and 18-mer DNA (ODN) at a site without nucleobase, either at the 5′- or 3′-end or at a internucleotide position, via linkers of 7, 12, or 18 atoms lengths. These dppz-linked ODNs were synthesized using novel backbone glycerol phosphoramidites: Glycerol, serving as artificial nucleoside without nucleobase, was modified to amines 10 , 23 , and 24 , which were suitable for the subsequent key reaction with dppz-carboxylic acid 3 (Schemes 2 and 3). The products of these reactions (see 5 – 7 ) were then transformed to the standard phosphoramidite derivatives (see 27 , 29 , and 30 ) or used for loading on a CPG support (see 28 , 31 , and 32 ). The dppz-modified ODNs were subsequently assembled in the usual manner using automated solid-phase DNA synthesis. The 9-mer ODN-dppz conjugates 35 – 43 were tested for their ability to form stable duplexes with target DNA or RNA strands (D11 ( 60 ) or R11 ( 61 )), while the 18-mer ODN-dppz conjugates 48 – 56 were tested for their ability to form stable triplexes with a DNA target duplex D24⋅D24 ( 62 ) (see Tables 1 and 2). The presence of the conjugated dppz derivative increases the stability of DNA⋅DNA and DNA⋅RNA duplexes, typically by a ΔT_m of 7.3 – 10.9° and 4.5 – 7.4°, respectively, when the dppz is tethered at the 5′- or 3′-terminal (Table 2). The dppz derivatives also stabilize triplexes when attached to the 5′- or 3′-end, with a ΔT_m varying from 3.8 – 11.1° (Table 3). The insertion of a dppz building block at the center of a 9-mer results in a considerably poorer stability of the corresponding DNA⋅DNA duplexes (ΔT_m=0.5 to 4.2°) and DNA⋅RNA duplexes (ΔT_m=−1.5 to 0.9°), while the replacement of one interior nucleotide by a dppz building unit in the corresponding 8-mer ODN does not reveal the formation of any duplex at all. Different types of modifications in the middle of the 18-mer ODN, in general, do not lead to any triplex formation, except when the dppz derivative is tethered to the ODN through a 12-atom-long linker (Entry 9 in Table 3).     

LNA (locked nucleic acid) and analogs as triplex-forming oligonucleotides

The triplex-forming abilities of some conformationally restricted nucleotide analogs are disclosed and compared herein. 2'-Amino-LNA monomers proved to be less stabilising to triplexes than LNA monomers when incorporated into a triplex-forming third strand. N2'-functionalisation of 2'-amino-LNA monomers with a glycyl unit induced the formation of exceptionally stable triplexes. Nucleotide analogs containing a C2',C3'-oxymethylene linker (E-type furanose conformation) or a C2',C4'-propylene linker (N-type furanose conformation) had no significant effect on triplex stability proving that conformational restriction per se is insufficient to stabilise triplexes.     

Detection of labeled abasic sites in damaged DNA by capillary electrophoresis with laser-induced fluorescence

Removal of nucleobases from the DNA backbone leads to the formation of abasic sites. The rate of abasic site formation is significantly increased for chemically damaged nucleobases. Thus, abasic sites serve as general biomarkers for the quantification of DNA damage. Herein, we show that capillary electrophoresis with laser-induced fluorescence (CE-LIF) can be used to detect the amount of abasic sites with very high sensitivity. For proof of concept, DNA was incubated with methylmethane sulfonate (MMS) and the damaged bases were removed by incubation at 80 °C. The resulting abasic sites were then tagged with a fluorescent aldehyde-reactive probe (FARP). The DNA was precipitated with ethanol, and then analyzed by CE-LIF. CE-LIF and HPLC analysis shows that the fluorescently tagged DNA (DNA-FARP) had a peak area directly proportional to the amount of N-7 methyl guanines. The CE-LIF method had a detection limit of 1.2 abasic sites per 1,000,000 bases or ca. 20 attomoles of abasic sites. This provides a general method for detecting DNA damage that is not only faster but also has comparable or better sensitivity than the alternative ELISA-like method.     

Studies of the intermolecular DNA triplexes of C+.GC and T.AT triplets by electrospray ionization Fourier-transform ion cyclotron resonance mass spectrometry

Formation and stabilities of four 14-mer intermolecular DNA triplexes, consisting of third strands with repeating sequence CTCT, CCTT, CTT, or TTT, were studied by electrospray ionization Fourier-transform ion cyclotron resonance mass spectrometry (ESI-FTICR-MS) in the gas phase. The gas-phase stabilities of the triplexes were compared with their CD spectra and melting behaviors in solution, and parallel correlation between two phases were obtained. In the presence of 20 mM NH(4) (+) (pH 5.5), the formation of the TTT triplex was not detected in both solution and the gas phase. Other triplexes showed the same order, CTCT > CCTT > CTT, of ion abundances in mass spectra and T(m) values in solution. The more stable triplexes are those that contained higher percentage of C(+).GC triplets and an alternating CT sequence. However, the CCTT with the same C(+).GC triplets as the CTCT showed a higher stability than the latter during the gas-phase dissociation. Furthermore, a biphasic triplex-to-duplex-to-single transition was detected in the gas phase, while a monophasic triplex-to-single dissociation was observed in solution. The present results reveal that hydrogen bonds and electrostatic interactions dominate in the gas phase, while base stacking and hydrophobic interactions dominate in solution to stabilize the triplexes. Moreover, weak acidic conditions (pH 5-6) promote the formation of the parallel triplexes.     

Characterization and mechanism of formation of tandem lesions in DNA by a nucleobase peroxyl radical

5,6-Dihydro-2'-deoxyuridin-6-yl (1) was independently generated via photolysis of 3. The radical is an analogue of the major reactive species produced from thymidine upon reaction with hydroxyl radical, which is the dominant DNA-damaging agent produced by the indirect effect of gamma-radiolysis. Under aerobic conditions, the peroxyl radical (2) derived from 1 reacts approximately 82% of the time with either the 5'- or 3'-adjacent nucleotide to produce two contiguously damaged nucleotides, known as tandem lesions. The structures and distribution of tandem lesions were investigated using probes that selectively detect abasic sites, ESI-MS/MS, and competition kinetics. In addition to 2-deoxyribonolactone, nonoxidized abasic sites were detected. 18O-Labeling verified that H2O was the source of oxygen in the abasic sites, but that O2 was the source of the oxygen in the 5,6-dihydro-6-hydroxy-2'-deoxyuridine derived from 2. ESI-MS/MS experiments, in conjunction with isotopic labeling, identified several products and provided direct evidence for peroxyl radical addition to the adjacent thymine bases. Kinetic studies revealed that peroxyl radical addition to the 5'-thymine was favored by approximately 4-5-fold over C1'-hydrogen atom abstraction from the respective deoxyribose ring, and that 2-deoxyribonolactone formation accounts for approximately 11% of the total amount of tandem lesions produced. These results suggest that tandem lesions, whose biochemical effects are largely unknown, constitute a major family of DNA damage products produced by the indirect effect of gamma-radiolysis.     

NMR studies of DNA single strands and DNA:RNA hybrids with and without 1-propynylation at C5 of oligopyrimidines

The 1-propynylation at C5 of consecutive pyrimidines in DNA can enhance DNA:RNA hybrid stability at 37 degrees C by over 1 kcal/mol of substitution [Barnes, T. W., III; Turner, D. H. J. Am. Chem. Soc.2001, 123, 4107-4118]. To provide information on the structural consequences of propynylation, two-dimensional NMR spectroscopy was used to study the structures of several oligonucleotides. Intraresidue nuclear Overhauser effect spectroscopy cross peaks were observed at 30 degrees C and a 200 ms mixing time in the H6-H1' region for 5'(dC(P)C(P)U(P)C(P)C(P)U(P)U(P)) (ssPrODN) but not for 5'(dCCUCCUU) (ssODN), suggesting preorganization of the propynylated single strand. NMR structures of the duplexes 5'(dC(P)C(P)U(P)C(P)C(P)U(P)U(P))3':3'(rGAGGAGGAAAU)5' (PrODN:RNA), 5'(dCC(P)U(P)C(P)C(P)U(P)U(P))3':3'(rGAGGAGGAAAU)5' (sPrODN1:RNA), and 5'(dCCUCCUU)3':3'(rGAGGAGGAAAU)5' (ODN:RNA) indicate that their global structures are almost identical. The NMR data, however, suggest that the 5'-end of sPrODN1:RNA is more dynamic than that of PrODN:RNA. In the propynylated duplexes, the propyne group stacks on the aromatic ring of the 5'-base and extends into the major groove. The results suggest that the increased stability of the propynylated duplexes is caused by preorganization of the propynylated single strand and different interactions in the double strand. The propynyl group provides volume exclusion, enhanced stacking, and possibly different solvation.     

Thermodynamics of translesion synthesis across a major DNA adduct of antitumor oxaliplatin: differential scanning calorimetric study

Differential scanning calorimetry (DSC) was used to measure the thermodynamic changes associated with translesion synthesis across major lesion induced in DNA by antitumor oxaliplatin [1,2-d(GG) intrastrand cross-link]. Insertion of matched nucleotides dC at the primer terminus (across unique 3'- or 5'-dG in the unplatinated template) and subsequent extensions resulted in an incremental increase in thermodynamic parameters. In contrast, incorporation of dC opposite either platinated dG in the intrastrand cross-link formed in the template strand and subsequent extensions by one nucleotide resulted only in little changes in thermodynamics. A similar thermodynamic delay was observed for a control template primer containing a dG:dT mismatch across 3'- or 5'-dG in the template and subsequent Watson-Crick primer extensions. The thermodynamic scarcity generated by either the lesion or mismatches was not localized but extended to the 5'-downstream sites, which may be connected with the phenomenon termed "short-term memory" of replication errors retained by some DNA polymerases responding to DNA damages or mismatches. Interestingly, formation of the 1,2-d(GG) intrastrand cross-link of oxaliplatin altered the overall DSC profiles of the dG:dT mismatch template/primers only in a very small extent. While addition of matched nucleotide dC across either dG in the template strand was thermodynamically favored over the presence of a mismatched dT (ΔΔG(0)(310) was 7.6 or 6.8 kJ mol(-1), ΔΔH was 14 or 49 kJ mol(-1)), no such thermodynamic advantage was observed with the 1,2-d(GG) intrastrand cross-link of oxaliplatin at these positions (ΔΔG(0)(310) was 2.8 or -0.3 kJ mol(-1), ΔΔH was 4 or 9 kJ mol(-1)). The equilibrium thermodynamic data also provide insight into the processes associated with misincorporation of incorrect nucleotides during replication bypass across major cross-links of antitumor oxaliplatin. On the other hand, besides thermodynamic effects also kinetic factors play an important role in the processing of the cross-links of antitumor platinum drugs. The impact of the two effects in overall processing DNA adducts by a particular DNA polymerase will depend on its nature.     

Solid-phase synthesis of positively charged deoxynucleic guanidine (DNG) tethering a Hoechst 33258 analogue: triplex and duplex stabilization by simultaneous minor groove binding

Deoxynucleic guanidine (DNG), a DNA analogue in which positively charged guanidine replaces the phosphodiester linkages, tethering to Hoechst 33258 fluorophore by varying lengths has been synthesized. A pentameric thymidine DNG was synthesized on solid phase in the 3' --> 5' direction that allowed stepwise incorporation of straight chain amino acid linkers and a bis-benzimidazole (Hoechst 33258) ligand at the 5'-terminus using PyBOP/HOBt chemistry. The stability of (DNA)(2).DNG-H triplexes and DNA.DNG-H duplexes formed by DNG and DNG-Hoechst 33258 (DNG-H) conjugates with 30-mer double-strand (ds) DNA, d(CGCCGCGCGCGCGAAAAACCCGGCGCGCGC)/d(GCGGCGCGCGCGCTTTTTGGGCCGCGCGCG), and single-strand (ss) DNA, 5'-CGCCGCGCGCGCGAAAAACCCGGCGCGCGC-3', respectively, has been evaluated by thermal melting and fluorescence emission experiments. The presence of tethered Hoechst ligand in the 5'-terminus of the DNG enhances the (DNA)(2).DNG-H triplex stability by a DeltaT(m) of 13 degrees C. The fluorescence emission studies of (DNA)(2).DNG-H triplex complexes show that the DNG moiety of the conjugates bind in the major groove while the Hoechst ligand resides in the A:T rich minor groove of dsDNA. A single G:C base pair mismatch in the target site decreases the (DNA)(2).DNG triplex stability by 11 degrees C, whereas (DNA)(2).DNG-H triplex stability was decreased by 23 degrees C. Inversion of A:T base pair into T:A base pair in the center of the binding site, which provides a mismatch selectively for DNG moiety, decreases the triplex stability by only 5-6 degrees C. Upon hybridization of DNG-Hoechst conjugates with the 30-mer ssDNA, the DNA.DNG-H duplex exhibited significant increase in the fluorescence emission due to the binding of the tethered Hoechst ligand in the generated DNA.DNG minor groove, and the duplex stability was enhanced by DeltaT(m) of 7 degrees C. The stability of (DNA)(2).DNG triplexes and DNA.DNG duplexes is independent of pH, whereas the stability of (DNA)(2).DNG-H triplexes decreases with increase in pH.