Analysis of egg-based model wall paintings by use of an innovative combined dot-ELISA and UPLC-based approach

The chemical analysis of egg-based wall paintings—the mezzo fresco technique—is an interesting topic in the characterisation of organic binders. A revised procedure for a dot-enzyme-linked immunosorbent assay (dot-ELISA) able to detect protein components of egg-based wall paintings is reported. In the new dot-ELISA procedure we succeeded in maximizing the staining colour by adjusting the temperature during the staining reaction. Quantification of the colour intensity by visible reflectance spectroscopy resulted in a straight line plot of protein concentration against reflectance in the wavelength range 380–780 nm. The modified dot-ELISA procedure is proposed as a semi-quantitative analytical method for characterisation of protein binders in egg-based paintings. To evaluate its performance, the method was first applied to standard samples (ovalbumin, whole egg, egg white), then to model specimens, and finally to real samples (Giotto’s wall paintings). Moreover, amino acid analysis performed by innovative ultra-performance liquid chromatography was applied both to standards and to model samples and the results were compared with those from the dot-ELISA tests. In particular, after protein hydrolysis (24 h, 114 °C, 6 mol L^?1 HCl) of the samples, amino acid derivatization by use of 6-aminoquinolyl-N-hydroxysuccinimidyl carbamate enabled reproducible analysis of amino acids. This UPLC amino acid analysis was rapid and reproducible and was applied for the first time to egg-based paintings. Because the painting technique involved the use of egg-based tempera on fresh lime-based mortar, the study enabled investigation of the effect of the alkaline environment on egg-protein detection by both methods.

Differences in the stable isotope signatures of seabird egg membrane and albumen – implications for non‐invasive studies

In many bird species, egg membranes can be obtained non‐invasively after the chicks have hatched, and stable isotope analysis of egg membranes can be used to study the diet and foraging distribution of these birds during egg formation. It has been suggested that the enrichment factors of albumen and egg membranes differ for ¹³C, but are similar for ¹⁵N. In this study, we compared carbon and nitrogen stable isotopes of the membranes and albumen of individual eggs of three wild seabird species, the Southern Rockhopper penguin Eudyptes chrysocome, the Imperial shag Phalacrocorax atriceps albiventer, and the Thin‐billed prion Pachyptila belcheri. We also included chicken eggs for comparison. Egg membranes were generally enriched in ¹³C, compared with albumen. The difference varied between species, with 2.1‰ in Rockhopper penguins, 1.6‰ in Imperial shags, but only 0.5‰ in Thin‐billed prions and 0.4‰ in chicken eggs. Egg membranes were slightly enriched in ¹⁵N in Imperial shags (0.9‰) and chickens (0.5‰), compared with albumen, while there was no difference for Thin‐billed prions and Rockhopper penguins. The isotopic values of carbon and nitrogen were correlated between albumen and egg membranes of individual eggs, suggesting that egg membranes can be used reliably to investigate trophic differences between individuals, seasons or colonies. Species‐specific mathematical corrections could be used to compare results across studies that use different egg components. Copyright © 2009 John Wiley & Sons, Ltd.     

Molecular Recognition of Rosmarinic Acid from Salvia sclareoides Extracts by Acetylcholinesterase: A New Binding Site Detected by NMR Spectroscopy

Acetylcholinesterase (AChE) inhibition is one of the most currently available therapies for the management of Alzheimer’s disease (AD) symptoms. In this context, NMR spectroscopy binding studies were accomplished to explain the inhibition of AChE activity by Salvia sclareoides extracts. HPLC‐MS analyses of the acetone, butanol and water extracts eluted with methanol and acidified water showed that rosmarinic acid is present in all the studied samples and is a major constituent of butanol and water extracts. Moreover, luteolin 4′‐O‐glucoside, luteolin 3′,7‐di‐O‐glucoside and luteolin 7‐O‐(6′′‐O‐acetylglucoside) were identified by MS² and MS³ data acquired during the LC‐MSⁿ runs. Quantification of rosmarinic acid by HPLC with diode‐array detection (DAD) showed that the butanol extract is the richest one in this component (134 μg mg^?1 extract). Saturation transfer difference (STD) NMR spectroscopy binding experiments of S. sclareoides crude extracts in the presence of AChE in buffer solution determined rosmarinic acid as the only explicit binder for AChE. Furthermore, the binding epitope and the AChE‐bound conformation of rosmarinic acid were further elucidated by STD and transferred NOE effect (trNOESY) experiments. As a control, NMR spectroscopy binding experiments were also carried out with pure rosmarinic acid, thus confirming the specific interaction and inhibition of this compound against AChE. The binding site of AChE for rosmarinic acid was also investigated by STD‐based competition binding experiments using Donepezil, a drug currently used to treat AD, as a reference. These competition experiments demonstrated that rosmarinic acid does not compete with Donepezil for the same binding site. A 3D model of the molecular complex has been proposed. Therefore, the combination of the NMR spectroscopy based data with molecular modelling has permitted us to detect a new binding site in AChE, which could be used for future drug development.     

Crystal Structure and Spectroscopic Characterization of Zinc(II) and Mercury(II) Complexes of N‐(Pyridin‐2‐ylmethylene)benzene‐1,4‐diamine

The behavior of N,N′‐bis(pyridin‐2‐ylmethylene)benzene‐1,4‐diamine (L) towards zinc(II), cadmium(II), and mercury(II) chlorides was studied in methanol solutions. In the presence of metal ions, the organic molecule was decomposed to N‐(pyridin‐2‐ylmethylene)benzene‐1,4‐diamine (L′), and complexes of general formula M(L′)Cl₂ were isolated from the mixture. The complexes were identified by elemental analysis, IR, ¹H NMR, and ¹³C NMR spectra, and their structures were further confirmed by single‐crystal X‐ray diffraction analysis of Zn(L′)Cl₂ and Hg(L′)Cl₂. In the solid state of both complexes, the molecules are stabilized by N–H ··· Cl hydrogen bonds and aromatic π–π stacking interactions.     

Studies of wall painting fragments from Kaiping Diaolou by SEM/EDX, micro Raman and FT-IR spectroscopy

The multi-technique analytical approach has proved to be a very effective tool for the analysis of artwork, as demonstrated by various studies. In this work, four micro-analysis methods were used to analyze the wall painting fragments in Kaiping Diaolou, a world cultural heritage enlisted in 2007. Field-emission scanning electron microscopy (FE-SEM), energy dispersive X-ray micro-analysis (EDX), combined with micro Raman and Fourier transform infrared (FT-IR) spectroscopy, provided a vast amount of information concerning the raw materials present in the pigments, organic binder, plasters and mortars of the wall painting. Four types of pigments (goethite, lazurite, chromium green and calcite) were identified on the surface layer of the wall paintings. The substrate under the pigment layer was found to be composed of cubic-like calcite (CaCO₃), micro-rod bundle-shaped syngenite (K₂Ca(SO₄)₂·H₂O), gypsum (CaSO₄·2H₂O) and silica (SiO₂). The organic binder can be attributed to animal glue (such as egg) and drying oil by micro FT-IR spectroscopy. These analysis results can provide important information for the conservation and restoration of the Kaiping Diaolou.     

N2: a potential pitfall for bulk 2H isotope analysis of explosives and other nitrogen‐rich compounds by continuous‐flow isotope‐ratio mass spectrometry

Observations made during the ¹³C isotope analysis of gaseous CO₂ in the simultaneous presence of argon in the ion source of the isotope ratio mass spectrometer prompted us to investigate what influence the simultaneous presence of nitrogen would have on both accuracy and precision of bulk ²H isotope analysis of nitrogen‐rich organic compounds. Initially an international reference material, IAEA‐CH7, was mixed with silver nitrate in various ratios to assess the impact that N₂ evolved from the pyrolysis of nitrogen‐rich organic compounds would have on measured δ²H‐values of IAEA‐CH7. In a subsequent experiment, benzoic acid was mixed with silver nitrate to mimic the N:H ratio of organic‐rich nitrogen compounds such as cellulose nitrate and RDX. The results of both experiments showed a significant deterioration of both accuracy and precision for the expected δ²H values for IAEA‐CH7 and benzoic acid when model mixtures were converted into hydrogen and nitrogen, and subsequently separated by gas chromatography using standard experimental conditions, namely a 60 cm packed column with molecular sieve 5 Å as stationary phase held at a temperature of 85°C. It was found that bulk ²H stable isotope analysis of nitrogen‐rich organic compounds employing published standard conditions can result in a loss of accuracy and precision yielding δ²H values that are 5 to 25‰ too negative, thus suggesting, for example, that tree‐ring ²H isotope data based on cellulose nitrate may have to be revised. Copyright © 2009 John Wiley & Sons, Ltd.     

Application of the selective 13C{1H} nuclear Overhauser effect to structure elucidation of photoadducts derived from maleic anhydrides and thiophene

The ¹³C NMR spectra of a representative series of photoadducts derived from methylmaleic anhydrides and thiophene, containing the same basic carbon skeleton, were studied in order to establish a model for future structure elucidation of similar compounds. Selective heteronuclear ¹³C{¹H} NOE was applied to stereochemical studies on the same compounds with the dual purpose of confirming previous assignments and to gain experience in the use of this technique, rarely applied in organic chemistry. The technique was employed in two different ways, by irradiating the selected proton resonance with and without modulation [ν_m=½J(CH)].     

Electronic Excitations in G‐quadruplexes Formed by the Human Telomeric Sequence: A Time‐Resolved Fluorescence Study

The present study deals with G‐quadruplexes formed by folding of the human telomeric sequence d(GGGTTAGGGTTAGGGTTAGGG), in presence of K⁺ cations, noted Tel21/K⁺. Fluorescence decays and fluorescence anisotropy decays, obtained upon excitation at 267 nm, are probed from femtosecond to nanosecond domains using two different detection techniques, fluorescence upconversion and time‐correlated single photon counting. The results are discussed in light of recent theoretical studies. It is shown that efficient energy transfer takes place among the bases on the femtosecond time scale, possible only via exciton states. The major part of the fluorescence originates from bright excited states having weak charge transfer character and decaying between 1 and 100 ps. Charge transfer states involving guanines in different tetrads decay mainly after 100 ps and emit at the red wing of the spectrum. The persistence of electronic excitations in Tel21/K⁺ is longer and the contribution of charge transfer states is more pronounced than what is observed for G‐quadruplexes formed by association of four d(TGGGT) strands and containing the same number of tetrads. This difference is due to the increased structural rigidity of monomolecular structures which reduces nonradiative deactivation pathways and favors collective effects.     

14C dating of ancient rock art: A new application of plasma chemistry

We have developed a new statically operated oxygen plasma method that allows direct¹⁴C dates to be obtained from ancient rock paintings. The method is applicable even to paintings on limestone (CaCO₃) walls. A sample of a pictograph which had naturally spalled offa shelter wall in the Lower Pecos region of Texas was subjected to a low temperature ( 150°C) oxygen plasma to selectively remove the organic carbon-containing material used in the paint as CO₂, without contamination from the limestone substrate. The Zürich EHT accelerator mass spectrometer was then used to determine the radiocarbon age of this prehistoric rock painting. It was successfully dated at 3865 ± 100 years BP, in good accord with the archaeological context which has set the onset of this Pecos River style of pictograph between 4100 and 3200 years BP. The method appears feasible and is applicable to rock art in which organic materials were used in the paint.     

Evidence that protons can be the active catalysts in Lewis acid mediated hetero-Michael addition reactions

The mechanism of Lewis acid catalysed hetero‐Michael addition reactions of weakly basic nucleophiles to α,β‐unsaturated ketones was investigated. Protons, rather than metal ions, were identified as the active catalysts. Other mechanisms have been ruled out by analyses of side products and of stoichiometric enone–catalyst mixtures and by the use of radical inhibitors. No evidence for the involvement of π‐olefin–metal complexes or for carbonyl–metal‐ion interactions was obtained. The reactions did not proceed in the presence of the non‐coordinating base 2,6‐di‐tert‐butylpyridine. An excellent correlation of catalytic activities with cation hydrolysis constants was obtained. Different reactivities of mono‐ and dicarbonyl substrates have been rationalised. A ¹H NMR probe for the assessment of proton generation was established and Lewis acids have been classified according to their propensity to hydrolyse in organic solvents. Brønsted acid‐catalysed conjugate addition reactions of nitrogen, oxygen, sulfur and carbon nucleophiles are developed and implications for asymmetric Lewis acid catalysis are discussed.     

Identification of tert‐Butyl Cations in Zeolite H‐ZSM‐5: Evidence from NMR Spectroscopy and DFT Calculations

Experimental evidence for the presence of tert‐butyl cations, which are important intermediates in acid‐catalyzed heterogeneous reactions, on solid acids has still not been provided to date. By combining density functional theory (DFT) calculations with ¹H/¹³C magic‐angle‐spinning NMR spectroscopy, the tert‐butyl cation was successfully identified on zeolite H‐ZSM‐5 upon conversion of isobutene by capturing this intermediate with ammonia.     

Binder Free Modification of Glassy Carbon Electrode by Employing Reduced Graphene Oxide/ZnO Composite for Voltammetric Determination of Certain Nitroaromatics

Reduced Graphene oxide/ZnO nanoflowers ( rGO/ZnO‐NFs ) composite has been synthesized in‐situ using asymmetric Zn complex ( 1 ) as a single‐source molecular precursor (SSMP) with GO at 150 °C. The rGO/ZnO‐NFs composite was characterized by PXRD, UV‐vis, SEM, EDX mapping, TEM and SAED pattern to confirm its purity and morphology. The rGO/ZnO‐NFs composite shows uniform distribution of nanoflowers on graphene sheets. The modified glassy carbon electrode ( GCE ) was fabricated by drop wise layering of the rGO/ZnO‐NFs composite at the surface of the GCE without using binder. The binder free modified electrode ( GCE‐rGO/ZnO ) was explored for detection of nitroaromatics such as p‐nitro‐phenol ( p ‐NP ), 2,4‐dinitrophenol ( 2,4‐DNP ), 2,4‐dinitrotoluene ( 2,4‐DNT ) and 2,4,6‐trinitrophenol ( 2,4,6‐TNP ). The fabricated sensor showed remarkable response for the both toxicants and explosives. The LOD, sensitivity and linear range for the studied toxicants and explosives were found to be in a good range: p ‐NP= 0.93 μM, 240 μA mM⁻¹ cm⁻² and 0.2–0.9 mM; 2,4‐DNP= 6.2 μM, 203 μA mM⁻¹ cm⁻² and 0.1–0.9 mM; 2,4‐DNT= 10 μM, 371 μA mM⁻¹ cm⁻² and 0.2–0.9 mM; 2,4,6‐TNP= 16 μM, 514 μA mM⁻¹ cm⁻² and 0.2–0.9 mM, respectively.     

Colloidal Template Synthesis of Nanomaterials by Using Microporous Organic Nanoparticles: The Case of C@MoS2 Nanoadsorbents

The so‐called colloidal template synthesis has been applied to the preparation of surface‐engineered nanoadsorbents. Colloidal microporous organic network nanotemplates (C‐MONs), which showed a high surface area (611 m² g^?1) and enhanced microporosity, were prepared through the networking of organic building blocks in the presence of poly(vinylpyrrolidone) (PVP). Owing to entrapment of the PVP in networks, the C‐MONs showed good colloidal dispersion in EtOH. MoS₂ precursors were incorporated into the C‐MONs and heat treatment afforded core–shell‐type C@MoS₂ nanoparticles with a diameter of 80 nm, a negative zeta potential (?39.5 mV), a high surface area (508 m² g^?1), and excellent adsorption performance towards cationic dyes (q_max=343.6 and 421.9 mg g^?1 for methylene blue and rhodamine B, respectively).     

An Improved,Scalable and Impurity‐Free Process for Lixivaptan

An optimized synthetic method in high efficiency has been developed for the synthesis of lixivaptan from 2‐nitrobenzyl bromide and pyrrole‐2‐carboxaldehyde. The byproducts among this procedure and an unknown impurity in crude product were investigated. The byproducts were speculated by ¹H NMR or MS. The unknown impurity was characterized by ¹H NMR, ¹³C NMR, and HRMS, confirming the structures as N‐[3‐chloro‐4‐(5H‐pyrrolo[2,1‐c][1,4]benzodiazepine‐10(11H)‐ylcarbonyl)phenyl]‐N‐(5‐fluoro‐2‐methylbenzoyl)‐5‐fluoro‐2‐methylbenzamide. Afterwards, the impurity was synthesized to make comparisons. The target product lixivaptan was obtained with 47.6% overall yield and 99.93% purity. This cost‐effective and environmentally friendly process is suitable for scale‐up production.     

Applications of stable isotope ratio mass spectrometry in cattle dung carbon cycling studies

Understanding the fate of dung carbon (C) in soils is challenging due to the ubiquitous presence of the plant‐derived organic matter (OM), the source material from which both dung‐derived OM and soil organic matter (SOM) predominantly originate. A better understanding of the fate of specific components of this substantial source of OM, and thereby its contribution to C cycling in terrestrial ecosystems, can only be achieved through the use of labelled dung treatments. In this short review, we consider analytical approaches using bulk and compound‐specific stable carbon isotope analysis that have been utilised to explore the fate of dung‐derived C in soils. Bulk stable carbon isotope analyses are now used routinely to explore OM matter cycling in soils, and have shown that up to 20% of applied dung C may be incorporated into the surface soil horizons several weeks after application, with up to 8% remaining in the soil profile after one year. However, whole soil δ¹³C values represent the average of a wide range of organic components with varying δ¹³C values and mean residence times in soils. Several stable ¹³C isotope ratio mass spectrometric methods have been developed to qualify and quantify different fractions of OM in soils and other complex matrices. In particular, thermogravimetry‐differential scanning calorimetry‐isotope ratio mass spectrometry (TG‐DSC‐IRMS) and gas chromatography‐combustion‐IRMS (GC‐C‐IRMS) analyses have been applied to determine the incorporation and turnover of polymeric plant cell wall materials from C₄ dung into C₃ grassland soils using natural abundance ¹³C isotope labelling. Both approaches showed that fluxes of C derived from polysaccharides, i.e. as cellulose or monosaccharide components, were more similar to the behaviour of bulk dung C in soil than lignin. However, lignin and its 4‐hydroxypropanoid monomers were unexpectedly dynamic in soil. These findings provide further evidence for emerging themes in biogeochemical investigations of soil OM dynamics that challenge perceived concepts of recalcitrance of C pools in soils, which may have profound implications for the assessment of the potential of agricultural soils to influence terrestrial C sinks. Copyright © 2010 John Wiley & Sons, Ltd.     

Identification of Intermediates in the Biosynthesis of PR Toxin by Penicillium roqueforti

The sesquiterpenoid 7‐epi‐neopetasone was synthesized via the Wieland–Miescher ketone. The compound was identical to a previously tentatively identified headspace constituent of Penicillium roqueforti. Feeding experiments with ¹³C‐labeled mevalonolactone isotopomers demonstrated that oxidation at C12 and an isomerization of the C11?C12 to a C7?C11 double bond must occur independently and not via a C7‐C11‐C12 allyl radical in one step. Feeding with (11,12,13‐¹³C₃)‐7‐epi‐neopetasone resulted in labelling of the PR toxin, thus establishing this compound as a newly identified pathway intermediate.     

Thermally curable organic/inorganic hybrid polymers as gate dielectrics for organic thin‐film transistors

New low‐temperature curable organic/inorganic hybrid polymers were designed and synthesized as gate dielectrics for organic thin‐film transistors (OTFTs). Allyl alcohols were introduced to polyhedral oligomeric silsesquioxane (POSS) via hydrosilyation to produce an alcohol‐functionalized POSS derivative (POSS‐OH). POSS‐OH was then reacted with hexamethoxymethylmelamine at carrying molar ratios at 80 °C in the presence of a catalytic amount of p‐toluenesulfonic acid to give highly cross‐linked network polymers (POSS‐MM). The prepared thin films were smooth and hard after the thermal cross‐linking reaction and had very low leakage currents (<10^?8 A/cm²) with no significant absorption over the visible spectral range. Pentacene‐based OTFTs using the synthesized insulators as gate dielectric layers had higher hole mobilities (up to 0.36 cm²/Vs) than a device using thermally cross‐linked poly(vinyl phenol) and melamine as the gate dielectric layer (0.18 cm²/Vs). © 2014 Wiley Periodicals, Inc. J. Polym. Sci., Part A: Polym. Chem. 2014 , 52, 3260–3268     

Non‐Innocent Ligand Effects on Low‐Oxidation‐State Indium Complexes

Attempts to coordinate neutral ligands to low oxidation state indium centers are often hindered by disproportionation pathways that produce elemental indium and higher oxidation state species. In contrast, we find that reactions of the salt, InOTf (OTf=trifluoromethanesulfonate), with α‐diimine ligands yielded intensely colored compounds with no evidence of decomposition. X‐ray structural analysis of InOTf ? ^MesDAB^Me (^MesDAB^Me=N,N‐dimesityl‐2,3‐dimethyl‐diazabutadiene; 1 ) reveals a discrete molecular compound with a pyramidal coordination environment at the indium center, consistent with the presence of a stereochemically active lone pair of electrons on indium and a neutral diazabutadiene chelate ligand. The use of the less‐electron‐rich ^MesDAB^H ligand (^MesDAB^H=N,N‐dimesityl‐diazabutadiene) engenders dramatically different reactivity and produces a metallopolymer (InOTf ? ^MesDAB^H)_∞ ( 2 ) linked via C? C and In? In bonds. The difference in reactivity is rationalized by cyclic voltammetry and DFT studies that suggest more facile electron transfer from In^I to the ^MesDAB^H and bis(aryl)acenaphthenequinonediimine (BIAN) ligands. Solution EPR spectroscopy indicates the presence of non‐interacting ligand‐based radicals in solution, whereas solid‐state EPR studies reflect the presence of a thermally accessible spin triplet consistent with reversible C? C bond cleavage.     

One‐pot inimer promoted ROCP synthesis of branched copolyesters using α‐hydroxy‐γ‐butyrolactone as the branching reagent

An array of branched poly(?‐caprolactone)s was successfully synthesized using an one‐pot inimer promoted ring‐opening multibranching copolymerization (ROCP) reaction. The biorenewable, commercially available yet unexploited comonomer and initiator 2‐hydroxy‐γ‐butyrolactone was chosen as the inimer to extend the use of 5‐membered lactones to branched structures and simultaneously avoiding the typical tedious work involved in the inimer preparation. Reactions were carried out both in bulk and in solution using stannous octoate (Sn(Oct)₂) as the catalyst. Polymerizations with inimer equivalents varying from 0.01 to 0.2 were conducted which resulted in polymers with a degree of branching ranging from 0.049 to 0.124. Detailed ROCP kinetics of different inimer systems were compared to illustrate the branch formation mechanism. The resulting polymer structures were confirmed by ¹H, ¹³C, and ₁H‐₁₃C HSQC NMR and SEC (RI detector and triple detectors). The thermal properties of polymers with different degree of branching were investigated by DSC, confirming the branch formation. Through this work, we have extended the current use of the non‐homopolymerizable γ‐butyrolactone to the branched polymers and thoroughly examined its behaviors in ROCP. © 2016 The Authors. Journal of Polymer Science Part A: Polymer Chemistry Published by Wiley Periodicals, Inc. J. Polym. Sci., Part A: Polym. Chem. 2016 , 54, 1908–1918     

From Alkanes to Carboxylic Acids: Terminal Oxygenation by a Fungal Peroxygenase

A new heme–thiolate peroxidase catalyzes the hydroxylation of n‐alkanes at the terminal position—a challenging reaction in organic chemistry—with H₂O₂ as the only cosubstrate. Besides the primary product, 1‐dodecanol, the conversion of dodecane yielded dodecanoic, 12‐hydroxydodecanoic, and 1,12‐dodecanedioic acids, as identified by GC–MS. Dodecanal could be detected only in trace amounts, and 1,12‐dodecanediol was not observed, thus suggesting that dodecanoic acid is the branch point between mono‐ and diterminal hydroxylation. Simultaneously, oxygenation was observed at other hydrocarbon chain positions (preferentially C2 and C11). Similar results were observed in reactions of tetradecane. The pattern of products formed, together with data on the incorporation of ¹⁸O from the cosubstrate H₂¹⁸O₂, demonstrate that the enzyme acts as a peroxygenase that is able to catalyze a cascade of mono‐ and diterminal oxidation reactions of long‐chain n‐alkanes to give carboxylic acids.