Sequence-specific alkylation by Y-shaped and tandem hairpin pyrrole-imidazole polyamides

To extend the target DNA sequence length of the hairpin pyrrole-imidazole (Py-Im) polyamide 1, we designed and synthesized Y-shaped and tandem hairpin Py-Im polyamides 2 and 3, which possess 1-(chloromethyl)-5-hydroxy-1,2-dihydro-3H-benz[e]indole (seco-CBI) as DNA-alkylating moieties. High-resolution denaturing polyacrylamide gel electrophoresis by using 5'-Texas-Red-labeled 465 base pair (bp) DNA fragments revealed that conjugates 2 and 3 alkylated the adenine of the target DNA sequences at nanomolar concentrations. Conjugate 2 alkylated adenine N3 at the 3' end of two 8 bp match sequences, 5'-AATAACCA-3' (site A) and 5'-AAATTCCA-3' (site C), while conjugate 3 recognized one 10 bp match sequence, 5'-AGAATAACCA-3' (site A) in the 465 bp DNA fragments. These results demonstrate that seco-CBI conjugates of Y-shaped and tandem hairpin polyamides have extended their target alkylation sequences.     

Sequence specific fluorescence detection of double strand DNA

Methods for the fluorescent detection of specific sequences of double strand DNA in homogeneous solution may be useful in the field of human genetics. A series of hairpin polyamides with tetramethyl rhodamine (TMR) attached to an internal pyrrole ring were synthesized, and the fluorescence properties of the polyamide-fluorophore conjugates in the presence and absence of duplex DNA were examined. We observe weak TMR fluorescence in the absence of DNA. Addition of >/=1:1 match DNA affords a significant fluorescence increase over equimolar mismatch DNA for each polyamide-TMR conjugate. Polyamide-fluorophore conjugates offer a new class of sensors for the detection of specific DNA sequences without the need for denaturation. The polyamide-dye fluorescence-based method can be used to screen in parallel the interactions between aromatic ring pairs and the minor groove of DNA even when the binding site contains a non-Watson-Crick DNA base pair. A ranking of the specificity of three polyamide ring pairs-Py/Py, Im/Py, and Im/Im-was established for all 16 possible base pairs of A, T, G, and C in the minor groove. We find that Im/Im is an energetically favorable ring pair for minor groove recognition of the T.G base pair.     

Neomycin-neomycin dimer: an all-carbohydrate scaffold with high affinity for AT-rich DNA duplexes

A dimeric neomycin-neomycin conjugate 3 with a flexible linker, 2,2'-(ethylenedioxy)bis(ethylamine), has been synthesized and characterized. Dimer 3 can selectively bind to AT-rich DNA duplexes with high affinity. Biophysical studies have been performed between 3 and different nucleic acids with varying base composition and conformation by using ITC (isothermal calorimetry), CD (circular dichroism), FID (fluorescent intercalator displacement), and UV (ultraviolet) thermal denaturation experiments. A few conclusions can be drawn from this study: (1) FID assay with 3 and polynucleotides demonstrates the preference of 3 toward AT-rich sequences over GC-rich sequences. (2) FID assay and UV thermal denaturation experiments show that 3 has a higher affinity for the poly(dA)·poly(dT) DNA duplex than for the poly(dA)·2poly(dT) DNA triplex. Contrary to neomycin, 3 destabilizes poly(dA)·2poly(dT) triplex but stabilizes poly(dA)·poly(dT) duplex, suggesting the major groove as the binding site. (3) UV thermal denaturation studies and ITC experiments show that 3 stabilizes continuous AT-tract DNA better than DNA duplexes with alternating AT bases. (4) CD and FID titration studies show a DNA binding site size of 10-12 base pairs/drug, depending upon the structure/sequence of the duplex for AT-rich DNA duplexes. (5) FID and ITC titration between 3 and an intramolecular DNA duplex [d(5'-A(12)-x-T(12)-3'), x = hexaethylene glycol linker] results in a binding stoichiometry of 1:1 with a binding constant ～10(8) M(-1) at 100 mM KCl. (6) FID assay using 3 and 512 hairpin DNA sequences that vary in their AT base content and placement also show a higher binding selectivity of 3 toward continuous AT-rich than toward DNA duplexes with alternate AT base pairs. (7) Salt-dependent studies indicate the formation of three ion pairs during binding of the DNA duplex d[5'-A(12)-x-T(12)-3'] and 3. (8) ITC-derived binding constants between 3 and DNA duplexes have the following order: AT continuous, d[5'-G(3)A(5)T(5)C(3)-3'] > AT alternate, d[5'-G(3)(AT)(5)C(3)-3'] > GC-rich d[5'-A(3)G(5)C(5)T(3)-3']. (9) 3 binds to the AT-tract-containing DNA duplex (B* DNA, d[5'-G(3)A(5)T(5)C(3)-3']) with 1 order of magnitude higher affinity than to a DNA duplex with alternating AT base pairs (B DNA, d[5'-G(3)(AT)(5)C(3)-3']) and with almost 3 orders of magnitude higher affinity than a GC-rich DNA (A-form, d[5'-A(3)G(5)C(5)T(3)-3']).     

Recognition of ten base pairs of DNA by head-to-head hairpin dimers

Hairpin polyamides coupled head-to head with alkyl linkers of varying lengths were synthesized, and their DNA binding properties were determined. The DNA binding affinities of six-ring hairpin dimers Im-Im-Py-(R)[Im-Im-Py-(R)(HNCO(CH))(n)(CO)gamma-Py-Py-Py-beta-Dp](NH)gamma-Im-Py-Py-beta-Dp (1-4) (where n = 1-4) for their 10-bp, 11-bp, and 12-bp match sites 5'-TGGCATACCA-3', 5'-TGGCATTACCA-3', and 5'-TGGCATATACCA-3' were determined by quantitative DNase I footprint titrations. The most selective dimer Im-Im-Py-(R)[Im-Im-Py-(R)(HNCO(CH)(2))(2)(CO)gamma-Py-Py-Py-beta-Dp](NH)gamma-Im-Py-Py-beta-Dp (2) binds the 10-bp site match site with an equilibrium association constant of K(a) = 7.5 x 10(10) M(-1) and displays 25- and 140-fold selectivity over the 11-bp and 12-bp match sites, respectively. The affinity toward single base pair mismatched sequences is 4- to 8-fold lower if one hairpin module of the dimer is affected, but close to 200-fold lower if both hairpin modules face a single mismatch base pair. The head-to-head hairpin dimer motif expands the binding site size of DNA sequences targetable with polyamides.     

DNA alkylation by pyrrole-imidazole seco-CBI conjugates with an indole linker: sequence-specific DNA alkylation with 10-base-pair recognition through heterodimer formation

The sequence-specific DNA alkylation by conjugates 4 and 5, which consist of N-methylpyrrole (Py)-N-methylimidazole (Im) polyamides and 1-(chloromethyl)-5-hydroxy-1,2-dihydro-3H-benz[e]indole (seco-CBI) linked with an indole linker, was investigated in the absence or presence of partner Py-Im polyamide 6. High-resolution denaturing polyacrylamide gel electrophoresis revealed that conjugate 4 alkylates DNA at the sequences 5'-(A/T)GCCTA-3' through hairpin formation, and alkylates 5'-GGAAAGAAAA-3' through an extended binding mode. However, in the presence of partner Py-Im polyamide 6, conjugate 4 alkylates DNA at a completely different sequence, 5'-AGGTTGTCCA-3'. Alkylation of 4 in the presence of 6 was effectively inhibited by a competitor 7. Surface plasmon resonance (SPR) results indicated that conjugate 4 does not bind to 5'-AGGTTGTCCA-3', whereas 6 binds tightly to this sequence. The results suggest that alkylation proceeds through heterodimer formation, indicating that this is a general way to expand the recognition sequence for DNA alkylation by Py-Im seco-CBI conjugates.     

Consecutive GC base pairs determine the energy barrier of DNA duplex formation under molecularly crowded conditions

The kinetics of DNA duplex formation was affected by the addition of PEGs with different masses (MW = 200-8000) to an aqueous solution; for each condition, two duplexes (5'-TAGGTTATAA-3'/5'-TTATAACCTA-3' and 5'-CAGGTCACAG-3'/5'-CTGTGACCTG-3') with different stabilities were formed after overcoming the same association activation energy barrier, suggesting that the formation of consecutive GC base pairs in the helices rather than the helix terminus is the initiation nucleus for DNA duplex formation not only in the absence, but also in the presence of PEGs.     

Discrimination of A/T sequences in the minor groove of DNA within a cyclic polyamide motif

Eight-ring cyclic polyamides containing pyrrole (Py), imidazole (Im), and hydroxypyrrole (Hp) aromatic amino acids recognize predetermined six base pair sites in the minor groove of DNA. Two four-ring polyamide subunits linked by (R)-2,4-diaminobutyric acid [(R)H2Ngamma] residue form hairpin polyamide structures with enhanced DNA binding properties. In hairpin polyamides, substitution of Hp/Py for Py/Py pairs enhances selectivity for T. A base pairs but compromises binding affinity for specific sequences. In an effort to enhance the binding properties of polyamides containing Hp/Py pairings, four eight ring cyclic polyamides were synthesized and analyzed on a DNA restriction fragment containing three 6-bp sites 5'-tAGNNCTt-3', where NN = AA, TA, or AT. Quantitative footprint titration experiments demonstrate that contiguous placement of Hp/Py pairs in cyclo-(gamma-ImPyPyPy-(R)H2Ngamma-ImHpHpPy-) (1) provides a 20-fold increase in affinity for the 5'-tAGAACTt-3' site (Ka = 7.5 x 10(7)M(-1)) relative to ImPyPyPy-(R)H2Ngamma-ImHpHpPy-C3-OH (2). A cyclic polyamide of sequence composition cyclo-(gamma-ImHpPyPy-(R)H2Ngamma-ImHpPyPy-) (3) binds a 5'-tAGTACTt-3' site with an equilibrium association constant KA= 3.2 x 10(9)M(-1), representing a fivefold increase relative to the hairpin analogue ImHpPyPy-(R)H2Ngamma-ImHpPyPy-C3-OH (4). Arrangement of Hp/Py pairs in a 3'-stagger regulates specificity of cyclo-(gamma-ImPyHpPy-(R)H2Ngamma-ImPyHpPy-) (5) for the 5'-tAGATCTt-3' site (Ka = 7.5 x 10(7)M(-1)) threefold increase in affinity relative to the hairpin analogue ImPyHpPy-(R)H2Ngamma-ImPyHpPy-C3-OH (6), respectively. This study identifies cyclic polyamides as a viable motif for restoring recognition properties of polyamides containing Hp/Py pairs.     

Sequence‐Specific DNA Alkylation by Tandem Py–Im Polyamide Conjugates

Tandem N‐methylpyrrole? N‐methylimidazole (Py? Im) polyamides with good sequence‐specific DNA‐alkylating activities have been designed and synthesized. Three alkylating tandem Py? Im polyamides with different linkers, which each contained the same moiety for the recognition of a 10 bp DNA sequence, were evaluated for their reactivity and selectivity by DNA alkylation, using high‐resolution denaturing gel electrophoresis. All three conjugates displayed high reactivities for the target sequence. In particular, polyamide 1 , which contained a β‐alanine linker, displayed the most‐selective sequence‐specific alkylation towards the target 10 bp DNA sequence. The tandem Py? Im polyamide conjugates displayed greater sequence‐specific DNA alkylation than conventional hairpin Py? Im polyamide conjugates ( 4 and 5 ). For further research, the design of tandem Py? Im polyamide conjugates could play an important role in targeting specific gene sequences.     

Discrimination of hairpin polyamides with an alpha-substituted-gamma-aminobutyric acid as a 5'-TG-3' reader in DNA minor groove

Pyrrole-imidazole (Py-Im) polyamides containing stereospecifically alpha-amino- or alpha-hydroxyl-substituted gamma-aminobutyric acid as a 5'-TG-3' recognition element were synthesized by machine-assisted Fmoc solid-phase synthesis. Their binding properties to predetermined DNA sequences containing a core binding site of 5'-TGCNCA-3'/3'-ACGN'GT-5' (N.N' = A.T, T.A, G.C, and C.G) were then systematically studied by surface plasmon resonance (SPR). SPR results revealed that the pairing of stereospecifically alpha-amino-/alpha-hydroxyl-substituted gamma-aminobutyric acids, (R or S)-alpha,gamma-diaminobutyric acid (gammaRN or gammaSN) and (R or S)-alpha-hydroxyl-gamma-aminobutyric acid (gammaRO or gammaSO), side-by-side with beta-alanine (beta) in such polyamides significantly influenced the DNA binding affinity and recognition specificity of hairpin polyamides in the DNA minor groove compared with beta/beta, beta/gamma, and gamma/beta pairings. More importantly, the polyamide Ac-Im-gammaSO-ImPy-gamma-ImPybetaPy-beta-Dp (beta/gammaSO) favorably binds to a hairpin DNA containing a core binding site of 5'-TGCNCA-3'/3'-ACGN'GT-5' (N.N' = A.T) with dissociation equilibrium constant (K(D)) of 1.9 x 10(-)(7) M over N.N' = T.A with K(D) = 3.7 x 10(-)(6) M, with a 19-fold specificity. By contrast, Ac-Im-gammaSN-ImPy-gamma-ImPybetaPy-beta-Dp (beta/gammaSN) binds to the above sequence with N.N' = A.T with K(D) = 8.7 x 10(-)(7) M over N.N' = T.A with K(D) = 8.4 x 10(-)(6) M, with a 9.6-fold specificity. The results also show that the stereochemistry of the alpha-substituent, as well as the alpha-substituent itself may greatly alter binding affinity and recognition selectivity of hairpin polyamides to different DNA sequences. Further, we carried out molecular modeling studies on the binding by an energy minimization method, suggesting that alpha-hydroxyl is very close to N3 of the 3'-terminal G to induce the formation of hydrogen bonding between hydroxyl and N3 in the recognition event of the polyamide Ac-Im-gammaSO-ImPy-gamma-ImPybetaPy-beta-Dp (beta/gammaSO) to 5'-TGCNCA-3'/3'-ACGN'GT-5' (N.N' = A.T). Therefore, SPR assays and molecular modeling studies collectively suggest that the (S)-alpha-hydroxyl-gamma-aminobutyric acid (gammaSO) may act as a 5'-TG-3' recognition unit.     

Sequence‐Specific DNA Recognition by Cyclic Pyrrole–Imidazole Cysteine‐Derived Polyamide Dimers

Pyrrole–imidazole (PI) polyamides bind to the minor groove of the DNA duplex in a sequence‐specific manner and thus have the potential to regulate gene expression. To date, various types of PI polyamides have been designed as sequence‐specific DNA binding ligands. One of these, cysteine cyclic PI polyamides containing two β‐alanine molecules, were designed to recognize a 7 bp DNA sequence with high binding affinity. In this study, an efficient cyclization reaction between a cysteine and a chloroacetyl residue was used for dimerization in the synthesis of a unit that recognizes symmetrical DNA sequences. To evaluate specific DNA binding properties, dimeric PI polyamide binding was measured by using a surface plasmon resonance (SPR) method. Extending this molecular design, we synthesized a large dimeric PI polyamide that can recognize a 14 bp region in duplex DNA.     

Observation of daunomycin and nogalamycin complexes with duplex DNA using electrospray ionisation mass spectrometry

The noncovalent binding of the antitumour drugs daunomycin and nogalamycin to duplex DNA has been studied using electrospray ionisation mass spectrometry (ESI-MS). The conditions for the preparation of drug/duplex DNA complexes and for their detection by ESI-MS have been optimised. Ions corresponding to these complexes were most abundant relative to free DNA when prepared in the pH range 8-9, and using gentle ESI interface conditions. Self-complementary oligonucleotides, 5'-d(GGCTAGCC)-3' or 5'-d(CGGCGCCG)-3', annealed in the presence of a 5-fold molar excess of either nogalamycin or daunomycin gave ESI mass spectra in which the most intense ions corresponded to three molecules of drug bound to duplex DNA, with some evidence for four drug molecules bound. For binding to 5'-d(TGAGCTAGCTCA)(2)-3', complexes containing up to four nogalamycin and six daunomycin molecules were observed. These data are consistent with the neighbour exclusion principle whereby intercalation occurs between every other base pair such that up to four bound drugs would be expected for the 8 mers and up to six for the 12 mer. Competition experiments involving a single drug in an equimolar mixture of two oligonucleotides (5'-d(TGAGCTAGCTCA)(2)-3' with either 5'-d(CGGCGCCG)(2)-3' or 5'-d(GGCTAGCC)(2)-3') showed ions arising from complexes of drug/5'-d(CGGCGCCG)(2)-3' were more intense than complexes of drug/5'-d(GGCTAGCC)(2)-3', relative to those from the 12 mer in each mixture. While this suggests ESI-MS has the potential to detect differences in sequence selectivity, more detailed experiments involving a comparison of the relative ionisation efficiency of different oligonucleotides and a wider range of intercalators are required to establish this definitively. ESI mass spectra from experiments in which both drugs were reacted with the same oligonucleotide were more complex, such that a clear preference for one drug could not be established.     

Cross-linking of a DNA conjugate tethering a cis-bifunctional platinated complex to a target DNA duplex

Tethering an ethylene diamine linker to the 5' terminus of an oligothymidine sequence provides a ligand for complexation with K2PtCl4. Post-synthetic reaction of the platinum reagent with the diamino oligothymidine generates the diamino dichloro platinum-DNA conjugate that can be used for DNA duplex targeting by oligodeoxyncleotide-mediated triplex formation. Cross-linking between the third strand and the duplex occurs exclusively with the duplex target strand directly involved in triplex formation. No examples of cross-linking to the complementary target strand or cases of cross-linking to both target strands are observed. Most efficient cross-linking occurs when the dinucleotide d(GpG) is present in the target strand and no cross-linking occurs with the corresponding 7-deazaG dinucleotide target. Cross-linking is also observed when dC or dA residues are present in the target strand, or even with a single dG residue, but it is not observed in any cases to dT residues. Triplex formation provides the ability to target specific sequences of double-stranded DNA; conjugates of the type described here offer the potential of delivering a platinum complex to a specific DNA site.     

Synthesis of a novel bicyclic nucleoside restricted to an S-type conformation and initial evaluation of its hybridization properties when incorporated into oligodeoxynucleotides.

The phosphoramidite (1S,3R,4S)-3-(2-cyanoethoxy(diisopropylamino)phosphinoxymethyl)-5-N-(4-monomethoxytrityl)-1-(uracil-1-yl)-5-aza-2-oxabicyclo[2.2.1]heptane 18 of a novel bicyclic nucleoside structure was synthesized from the known 1-(3'-deoxy-beta-D-psicofuranosyl)uracil 3. Conformational analysis of its structure verified its expected S-type furanose conformation, and the secondary amino group in the 4'-position allowed for incorporation into oligonucleotides using 5' --> 3' directed oligonucleotide synthesis as previously described for phosphoramidates. Thermal denaturation studies showed rather large decreases in duplex stabilities of -4.3 and -2.7 degrees C per modification toward complementary DNA and RNA, respectively.     

Parallel synthesis of H-pin polyamides by alkene metathesis on solid phase

A small library of H-pin polyamides with variable aliphatic bridge lengths (CH(2))(n)(), where n = 4-8, connecting a central Py/Py pair was prepared via parallel synthesis with Ru-catalyzed alkene metathesis on solid phase as a complexity-generating cross-linking reaction. DNA binding affinities and sequence specificities were analyzed for each member of the library to determine the optimum linker length. An H-pin polyamide with a six-methylene bridge was found to have the highest affinity to its match site with high selectivity over a 1-bp mismatch site. The relationship between the number of methylenes in the linker (CH(2))(n)() and affinity is n = 6 > 4 > 7 > 5 > 8. These results indicate that 6 followed by 4 methylene-bridged polyamides represent the optimum spacer length for the H-pin motif in the DNA minor groove. Importantly, the H-pin is competitive with hairpin polyamides with respect to affinity and specificity. The metathesis-based convergent synthetic route to H-pin polyamides expands the scope of readily available DNA recognition motifs for small molecule-based gene regulation studies.     

Long-range cooperativity in molecular recognition of RNA by oligodeoxynucleotides with multiple C5-(1-propynyl) pyrimidines.

A heptamer composed of C5-(1-propynyl) pyrimidines (Y(p)'s) is a potent and specific antisense agent against the mRNA of SV40 large T antigen (Wagner, R. W.; Matteucci, M. D.; Grant, D.; Huang, T.; Froehler, B. C. Nat. Biotechnol. 1996, 14, 840-844). To characterize the role of the propynyl groups in molecular recognition, thermodynamic increments associated with substitutions in DNA:RNA duplexes, such as 5'-dCCUCCUU-3':3'-rGAGGAGGAAAU-5', have been measured by UV melting experiments. For nucleotides tested, an unpaired dangling end stabilizes unmodified and propynylated duplexes similarly, except that addition of a 5' unpaired rA is 1.4 kcal/mol more stabilizing on the propynylated, PODN:RNA, duplex than on the DNA:RNA duplex. Free energy increments for addition of single propynyl groups range from 0 to -4.0 kcal/mol, depending on the final number and locations of substitutions. A preliminary model for predicting the stabilities of Y(p)-containing hybrid duplexes is presented. Eliminating one amino group, and therefore a hydrogen bond, by substituting inosine (I) for guanosine (G), to give 5'-dC(p)C(p)U(p)C(p)C(p)U(p)U(p)-3':3'-rGAGIAGGAAAU-5', destabilizes the duplex by 3.9 kcal/mol, compared to 1.7 kcal/mol for the same change within the unpropynylated duplex. This 2.2 kcal/mol difference is eliminated by removing a single propynyl group three base pairs away. CD spectra suggest that single propynyl deletions within the PODN:RNA duplex have position-dependent effects on helix geometry. The results suggest long-range cooperativity between propynyl groups and provide insights for rationally programming oligonucleotides with enhanced binding and specificity. This can be exploited in developing technologies that are dependent upon nucleic acid-based molecular recognition.     

Screening of threading bis-intercalators binding to duplex DNA by electrospray ionization tandem mass spectrometry

The DNA binding of novel threading bis-intercalators V1, trans-D1, and cis-C1, which contain two naphthalene diimide (NDI) intercalation units connected by a scaffold, was evaluated using electrospray ionization mass spectrometry (ESI-MS) and DNAse footprinting techniques. ESI-MS experiments confirmed that V1, the ligand containing the -Gly3-Lys- peptide scaffold, binds to a DNA duplex containing the 5'-GGTACC-3' specific binding site identified in previous NMR-based studies. The ligand formed complexes with a ligand/DNA binding stoichiometry of 1:1, even when there was excess ligand in solution. Trans-D1 and cis-C1 are new ligands containing a rigid spiro-tricyclic scaffold in the trans- and cis- orientations, respectively. Preliminary DNAse footprinting experiments identified possible specific binding sites of 5'-CAGTGA-5' for trans-D1 and 5'-GGTACC-3' for cis-C1. ESI-MS experiments revealed that both ligands bound to DNA duplexes containing the respective specific binding sequences, with cis-C1 exhibiting the most extensive binding based on a higher fraction of bound DNA value. Cis-C1 formed complexes with a dominant 1:1 binding stoichiometry, whereas trans-D1 was able to form 2:1 complexes at ligand/DNA molar ratios >or=1 which is suggestive of nonspecific binding. Collisional activated dissociation (CAD) experiments indicate that DNA complexes containing V1, trans-D1, and cis-C1 have a unique fragmentation pathway, which was also observed for complexes containing the commercially available bis-intercalator echinomycin, as a result of similar binding interactions, marked by intercalation in addition to hydrogen bonding by the scaffold with the DNA major or minor groove.     

Influence of a terminal formamido group on the sequence recognition of DNA by polyamides

Pyrrole (Py)-imidazole (Im)-containing polyamides bind in the minor groove of DNA and can recognize specific sequences through a stacked antiparallel dimer. It has been proposed that there are two different low energy ways to form the stacked dimer and that these are sensitive to the presence of a terminal formamido group: (i) a fully overlapped stacking mode in which the N-terminal heterocycles of the dimer stack on the amide groups between the two heterocycles at the C-terminal and (ii) a staggered stacking mode in which the N-terminal heterocycles are shifted by approximately one unit in the C-terminal direction (Structure 1997, 5, 1033-1046). Two different DNA sequences will be recognized by the same polyamide stacked in these two different modes. Despite the importance of polyamides as sequence specific DNA recognition agents, these stacking possibilities have not been systematically explored. As part of a program to develop agents that can recognize mismatched base pairs in DNA, a set of four polyamide trimers with and without terminal formamido groups was synthesized, and their interactions with predicted DNA recognition sequences in the two different stacking modes were evaluated. Experimental difficulties in monitoring DNA complex formation with polyamides were overcome by using surface plasmon resonance (SPR) detection of the binding to immobilized DNA hairpin duplexes. Both equilibrium and kinetic results from SPR show that a terminal formamido group has a pronounced effect on the affinity, sequence specificity, and rates of DNA-dimer complex formation. The formamido polyamides bind preferentially in the staggered stacking mode, while the unsubstituted analogues bind in the overlapped mode. Affinities for cognate DNA sequences increase by a factor of around 100 when a terminal formamido is added to a polyamide, and the preferred sequences recognized are also different. Both the association and the dissociation rates are slower for the formamido derivatives, but the effect is larger for the dissociation kinetics. The formamido group thus strongly affects the interaction of polyamides with DNA and changes the preferred DNA sequences that are recognized by a specific polyamide stacked dimer.     

Sequence-specific alkylation of double-strand human telomere repeat sequence by pyrrole-imidazole polyamides with indole linkers

We designed and synthesized pyrrole (Py)-imidazole (Im) hairpin polyamide 1-(chloromethyl)-5-hydroxy-1,2-dihydro-3H-benz[e]indole (seco-CBI) conjugates 1 and 2, which target both strands of the double-stranded region of the human telomere repeat sequences, 5'-d(TTAGGG)(n)-3'/5'-d(CCCTAA)(n)-3'. High-resolution denaturing polyacrylamide gel electrophoresis demonstrated that conjugates 1 and 2 alkylated DNA at the 3' A of 5'-ACCCTA-3' and 5'-AGGGTTA-3', respectively. Cytotoxicities of conjugates 1 and 2 were evaluated using 39 human cancer cell lines; averages of log IC(50) values for conjugates 1 and 2 were -6.96 (110 nM) and -7.24 (57.5 nM), respectively. Conjugates 1 and 2 have potential as antitumor drugs capable of targeting telomere repeat sequence.     

Specific adenine alkylation by pyrrole-imidazole CBI conjugates

We examined DNA alkylation by pyrrole (Py)-imidazole (Im) hairpin polyamides, which possess 1,2,9,9a-tetrahydrocyclopropa[1,2-c]benz[1,2-e]indol-4-one (CBI) or cyclopropapyrroloindole (CPI) as DNA alkylating moieties. High-resolution denaturing gel electrophoresis revealed that alkylation by CBI conjugates 2 and 4 occurred specifically at adenines (A) in matched sequences, whereas CPI conjugates 1 and 3 alkylated both A and guanines (G) in matched sequences. The origin of the different reactivity of CBI and CPI conjugates is discussed in relation to the electrophilicity of the cyclopropane moiety. The high selectivity of the CBI conjugate gives additional sequence specificity relative to CPI conjugates that would be useful for the biological applications.     

Solid-phase synthesis of positively charged deoxynucleic guanidine (DNG) tethering a Hoechst 33258 analogue: triplex and duplex stabilization by simultaneous minor groove binding

Deoxynucleic guanidine (DNG), a DNA analogue in which positively charged guanidine replaces the phosphodiester linkages, tethering to Hoechst 33258 fluorophore by varying lengths has been synthesized. A pentameric thymidine DNG was synthesized on solid phase in the 3' --> 5' direction that allowed stepwise incorporation of straight chain amino acid linkers and a bis-benzimidazole (Hoechst 33258) ligand at the 5'-terminus using PyBOP/HOBt chemistry. The stability of (DNA)(2).DNG-H triplexes and DNA.DNG-H duplexes formed by DNG and DNG-Hoechst 33258 (DNG-H) conjugates with 30-mer double-strand (ds) DNA, d(CGCCGCGCGCGCGAAAAACCCGGCGCGCGC)/d(GCGGCGCGCGCGCTTTTTGGGCCGCGCGCG), and single-strand (ss) DNA, 5'-CGCCGCGCGCGCGAAAAACCCGGCGCGCGC-3', respectively, has been evaluated by thermal melting and fluorescence emission experiments. The presence of tethered Hoechst ligand in the 5'-terminus of the DNG enhances the (DNA)(2).DNG-H triplex stability by a DeltaT(m) of 13 degrees C. The fluorescence emission studies of (DNA)(2).DNG-H triplex complexes show that the DNG moiety of the conjugates bind in the major groove while the Hoechst ligand resides in the A:T rich minor groove of dsDNA. A single G:C base pair mismatch in the target site decreases the (DNA)(2).DNG triplex stability by 11 degrees C, whereas (DNA)(2).DNG-H triplex stability was decreased by 23 degrees C. Inversion of A:T base pair into T:A base pair in the center of the binding site, which provides a mismatch selectively for DNG moiety, decreases the triplex stability by only 5-6 degrees C. Upon hybridization of DNG-Hoechst conjugates with the 30-mer ssDNA, the DNA.DNG-H duplex exhibited significant increase in the fluorescence emission due to the binding of the tethered Hoechst ligand in the generated DNA.DNG minor groove, and the duplex stability was enhanced by DeltaT(m) of 7 degrees C. The stability of (DNA)(2).DNG triplexes and DNA.DNG duplexes is independent of pH, whereas the stability of (DNA)(2).DNG-H triplexes decreases with increase in pH.