共查询到20条相似文献,搜索用时 625 毫秒
1.
Andrew P. Mendham Trevor J. Dines Robert Withnall John C. Mitchell Babur Z. Chowdhry 《Journal of Raman spectroscopy : JRS》2009,40(11):1498-1507
Solid‐state protonated and N,O‐deuterated Fourier transform infrared (IR) and Raman scattering spectra together with the protonated and deuterated Raman spectra in aqueous solution of the cyclic di‐amino acid peptide cyclo(L ‐Asp‐L ‐Asp) are reported. Vibrational band assignments have been made on the basis of comparisons with previously cited literature values for diketopiperazine (DKP) derivatives and normal coordinate analyses for both the protonated and deuterated species based upon DFT calculations at the B3‐LYP/cc‐pVDZ level of the isolated molecule in the gas phase. The calculated minimum energy structure for cyclo(L ‐Asp‐L ‐Asp), assuming C2 symmetry, predicts a boat conformation for the DKP ring with both the two L ‐aspartyl side chains being folded slightly above the ring. The CO stretching vibrations have been assigned for the side‐chain carboxylic acid group (e.g. at 1693 and 1670 cm−1 in the Raman spectrum) and the cis amide I bands (e.g. at 1660 cm−1 in the Raman spectrum). The presence of two bands for the carboxylic acid CO stretching modes in the solid‐state Raman spectrum can be accounted for by factor group splitting of the two nonequivalent molecules in a crystallographic unit cell. The cis amide II band is observed at 1489 cm−1 in the solid‐state Raman spectrum, which is in agreement with results for cyclic di‐amino acid peptide molecules examined previously in the solid state, where the DKP ring adopts a boat conformation. Additionally, it also appears that as the molecular mass of the substituent on the Cα atom is increased, the amide II band wavenumber decreases to below 1500 cm−1; this may be a consequence of increased strain on the DKP ring. The cis amide II Raman band is characterized by its relatively small deuterium shift (29 cm−1), which indicates that this band has a smaller N H bending contribution than the trans amide II vibrational band observed for linear peptides. Copyright © 2009 John Wiley & Sons, Ltd. 相似文献
2.
Andrew P. Mendham Brian S. Potter Rex A. Palmer Trevor J. Dines John C. Mitchell Robert Withnall Babur Z. Chowdhry 《Journal of Raman spectroscopy : JRS》2010,41(2):148-159
Experimental Raman and FT‐IR spectra of solid‐state non‐deuterated and N‐deuterated samples of cyclo(L ‐Met‐L ‐Met) are reported and discussed. The Raman and FT‐IR results show characteristic amide I vibrations (Raman: 1649 cm−1, infrared: 1675 cm−1) for molecules exhibiting a cis amide conformation. A Raman band, assigned to the cis amide II vibrational mode, is observed at ∼1493 cm−1 but no IR band is observed in this region. Cyclo(L ‐Met‐L ‐Met) crystallises in the triclinic space group P1 with one molecule per unit cell. The overall shape of the diketopiperazine (DKP) ring displays a (slightly distorted) boat conformation. The crystal packing employs two strong hydrogen bonds, which traverse the entire crystal via translational repeats. B3‐LYP/cc‐pVDZ calculations of the structure of the molecule predict a boat conformation for the DKP ring, in agreement with the experimentally determined X‐ray structure. Copyright © 2009 John Wiley & Sons, Ltd. 相似文献
3.
Andrew P. Mendham Trevor J. Dines Martin J. Snowden Babur Z. Chowdhry Robert Withnall 《Journal of Raman spectroscopy : JRS》2009,40(11):1478-1497
Investigations of the vibrational spectra of cyclo(Gly‐Gly), cyclo(L‐Ala‐L ‐Ala) and cyclo(L ‐Ala‐Gly) are reported. Raman scattering and Fourier transform infrared (FTIR) spectra of solid‐state and aqueous protonated samples, as well as their corresponding N‐deuterated isotopomers, have been examined. In addition, density functional theory (DFT) (B3‐LYP/cc‐pVDZ) calculations of molecular structures and their associated vibrational modes were carried out. In each case, the calculated structures of lowest energy for the isolated gas‐phase molecules have boat conformations. Assignments have been made for the observed Raman and FTIR vibrational bands of the cyclic di‐amino acid peptides (CDAPs) examined. Raman polarization studies of aqueous phase samples are consistent with C2 and C1 symmetries for the six‐membered rings of cyclo(L‐Ala‐L‐Ala) and cyclo(L‐Ala‐Gly), respectively. There is a good correlation between experimental and calculated vibrational bands for the three CDAPs. These data are in keeping with boat conformations for cyclo(L‐Ala‐L‐Ala) and cyclo(L‐Ala‐Gly) molecules, predicted by the ab initio calculations, in both the solid and aqueous solution states. However, Raman spectroscopic results might infer that cyclo(L‐Ala‐Gly) deviates only slightly from planarity in the solid state. The potential energy distributions of the amide I and II modes of a cis‐peptide linkage are shown to be significantly different from those of the trans‐peptides. For example, deuterium shifts have shown that the cis‐amide I vibrations found in cyclo(Gly‐Gly), cyclo(L‐Ala‐L‐Ala), and cyclo(L‐Ala‐Gly) have larger N‐H contributions compared to their trans‐amide counterparts. Compared to trans‐amide II vibrations, cis‐amide II vibrations show a considerable decrease in N H character. Copyright © 2009 John Wiley & Sons, Ltd. 相似文献
4.
Edyta Podstawka Pawe Kafarski Leonard M. Proniewicz 《Journal of Raman spectroscopy : JRS》2008,39(12):1726-1739
A comparative study of molecular structures of five L ‐proline (L ‐Pro) phosphonodipeptides: L ‐Pro‐NH‐C(Me,Me)‐PO3H2 (P1), L ‐Pro‐NH‐C(Me,iPr)‐PO3H2 (P2), L ‐Pro‐L ‐NH‐CH(iBu)‐PO3H2 (P3), L ‐Pro‐L ‐NH‐CH(PA)‐PO3H2 (P4) and L ‐Pro‐L ‐NH‐CH(BA)‐PO3H2 (P5) has been carried out using Raman and absorption infrared techniques of molecular spectroscopy. The interpretation of the obtained spectra has been supported by density functional theory calculations (DFT) at the B3LYP; 6–31 + + G** level using Gaussian 2003 software. The surface‐enhanced Raman scattering (SERS) on Ag‐sol in aqueous solutions of these phosphonopeptides has also been investigated. The surface geometry of these molecules on a silver colloidal surface has been determined by observing the position and relative intensity changes of the Pro ring, amide, phosphonate and so‐called spacer (−R) groups vibrations of the enhanced bands in their SERS spectra. Results show that P4 and P5 adsorb onto the silver as anionic molecules mainly via the amide bond (∼1630, ∼1533, ∼1248, ∼800 and ∼565 cm−1), Pro ring (∼956, ∼907 and ∼876 cm−1) and carboxylate group (∼1395 and ∼909 cm−1). Coadsorption of the imine nitrogen atom and PO group with the silver surface, possibly by formation of a weaker interaction with the metal, is also suggested by the enhancement of the bands at 1158 and 1248 cm−1. P1, P2 and P3 show two orientations of their main chain on the silver surface resulting from different interactions of the C CH3, NH and CONH fragments with this surface. Bonding to the Ag surface occurs mainly through the imino atom (1166 cm−1) for P2, while for P1 and P3 it occurs via the methyl group(s) (1194–1208 cm−1). The amide group functionality (CONH) is practically not involved in the adsorption process for P1 and P2, whereas the Cs P bonds do assist in the adsorption. Copyright © 2008 John Wiley & Sons, Ltd. 相似文献
5.
Andrew P. Mendham Rex A. Palmer Brian S. Potter Trevor J. Dines Martin J. Snowden Robert Withnall Babur Z. Chowdhry 《Journal of Raman spectroscopy : JRS》2010,41(3):288-302
Cyclo(L ‐Glu‐L ‐Glu) has been crystallised in two different polymorphic forms. Both polymorphs are monoclinic, but form 1 is in space group P21 and form 2 is in space group C2. Raman scattering and FT‐IR spectroscopic studies have been conducted for the N,O‐protonated and deuterated derivatives. Raman spectra of orientated single crystals, solid‐state and aqueous solution samples have also been recorded. The different hydrogen‐bonding patterns for the two polymorphs have the greatest effect on vibrational modes with N H and CO stretching character. DFT (B3‐LYP/cc‐pVDZ) calculations of the isolated cyclo(L ‐Glu‐L ‐Glu) molecule predict that the minimum energy structure, assuming C2 symmetry, has a boat conformation for the diketopiperazine ring with the two L ‐Glu side chains being folded above the ring. The calculated geometry is in good agreement with the X‐ray crystallographic structures for both polymorphs. Normal coordinate analysis has facilitated the band assignments for the experimental vibrational spectra. Copyright © 2009 John Wiley & Sons, Ltd. 相似文献
6.
Vibrational bands of L ‐tryptophan which was adsorbed on Ag nanoparticles (∼10 nm in diameter) have been investigated in the spectral range of 200–1700 cm−1 using surface‐enhanced Raman scattering (SERS) spectroscopy. Compared with the normal Raman scattering (NRS) of L ‐tryptophan in either 0.5 M aqueous solution (NRS‐AS) or solid powder (NRS‐SP), the intensified signals by SERS have made the SERS investigation at a lower molecular concentration (5 × 10−4 M ) possible. Ab initio calculations at the B3LYP/6‐311G level have been carried out to predict the optimal structure and vibrational wavenumbers for the zwitterionic form of L ‐tryptophan. Facilitated with the theoretical prediction, the observed vibrational modes of L ‐tryptophan in the NRS‐AS, NRS‐SP, and SERS spectra have been analyzed. In the spectroscopic observations, there are no significant changes for the vibrational bands of the indole ring in either NRS‐AS, NRS‐SP, or SERS. In contrast, spectral intensities involving the vibrations of carboxylate and amino groups are weak in NRS‐AS and NRS‐SP, but strong in SERS. The intensity enhancement in the SERS spectrum can reach 103–104‐fold magnification. On the basis of spectroscopic analysis, the carboxylate and amino groups of L ‐tryptophan are determined to be the preferential terminal groups to attach onto the surfaces of Ag nanoparticles in the SERS measurement. Copyright © 2008 John Wiley & Sons, Ltd. 相似文献
7.
Edyta Podstawka Magorzata
wiatowska Ewa Borowiec Leonard M. Proniewicz 《Journal of Raman spectroscopy : JRS》2007,38(3):356-363
Fourier‐transform infrared (FT‐IR), Raman (RS), and surface‐enhanced Raman scattering (SERS) spectra of β‐hydroxy‐β‐methylobutanoic acid (HMB), L ‐carnitine, and N‐methylglycocyamine (creatine) have been measured. The SERS spectra have been taken from species adsorbed on a colloidal silver surface. The respective FT‐IR and RS band assignments (solid‐state samples) based on the literature data have been proposed. The strongest absorptions in the FT‐IR spectrum of creatine are observed at 1398, 1615, and 1699 cm−1, which are due to νs(COOH) + ν(CN) + δ(CN), ρs(NH2), and ν(C O) modes, respectively, whereas those of L ‐carnitine (at 1396/1586 cm−1 and 1480 cm−1) and HMB (at 1405/1555/1585 cm−1 and 1437–1473 cm−1) are associated with carboxyl and methyl/methylene group vibrations, respectively. On the other hand, the strongest bands in the RS spectrum of HMB observed at 748/1442/1462 cm−1 and 1408 cm−1 are due to methyl/methylene deformations and carboxyl group vibrations, respectively. The strongest Raman band of creatine at 831 cm−1 (ρw(R NH2)) is accompanied by two weaker bands at 1054 and 1397 cm−1 due to ν(CN) + ν(R NH2) and νs(COOH) + ν(CN) + δ(CN) modes, respectively. In the case of L ‐carnitine, its RS spectrum is dominated by bands at 772 and 1461 cm−1 assigned to ρr(CH2) and δ(CH3), respectively. The analysis of the SERS spectra shows that HMB interacts with the silver surface mainly through the COO−, hydroxyl, and CH2 groups, whereas L ‐carnitine binds to the surface via COO− and N+(CH3)3 which is rarely enhanced at pH = 8.3. On the other hand, it seems that creatine binds weakly to the silver surface mainly by NH2, and C O from the COO− group. Copyright © 2006 John Wiley & Sons, Ltd. 相似文献
8.
Marcelo M. Campos‐Vallette Nancy P. Chandía Ernesto Clavijo David Leal Betty Matsuhiro Igor O. Osorio‐Romn Simonet Torres 《Journal of Raman spectroscopy : JRS》2010,41(7):758-763
The surface‐enhanced Raman scattering (SERS) of sodium alginates and their hetero‐ and homopolymeric fractions obtained from four seaweeds of the Chilean coast was studied. Alginic acid is a copolymer of β‐D ‐mannuronic acid (M) and α‐L guluronic acid (G), linked 1 → 4, forming two homopolymeric fractions (MM and GG) and a heteropolymeric fraction (MG). The SERS spectra were registered on silver colloid with the 632.8 nm line of a He Ne laser. The SERS spectra of sodium alginate and the polyguluronate fraction present various carboxylate bands which are probably due to the coexistence of different molecular conformations. SERS allows to differentiate the hetero‐ and homopolymeric fractions of alginic acid by characteristic bands. In the fingerprint region, all the poly‐D ‐mannuronate samples present a band around 946 cm−1 assigned to C O stretching, and C C H and C O H deformation vibrations, a band at 863 cm−1 assigned to deformation vibration of β‐C1 H group, and one at 799–788 cm−1 due to the contributions of various vibration modes. Poly‐L ‐guluronate spectra show three characteristic bands, at 928–913 cm−1 assigned to symmetric stretching vibration of C O C group, at 890–889 cm−1 due to C C H, skeletal C C, and C O vibrations, and at 797 cm−1 assigned to α C1 H deformation vibration. The heteropolymeric fractions present two characteristic bands in the region with the more important one being an intense band at 730 cm−1 due to ring breathing vibration mode. Copyright © 2009 John Wiley & Sons, Ltd. 相似文献
9.
Hartmut Rokos John M. Wood Sybille Hasse Karin U. Schallreuter 《Journal of Raman spectroscopy : JRS》2008,39(9):1214-1218
In the past, non‐invasive in vivo FT‐Raman spectroscopy has been used to detect H2O2‐mediated oxidation of methionine to methionine sulfoxide and methionine sulfone, as well as cysteine to cysteic acid, in the sequence of proteins in the epidermis of patients with vitiligo. L ‐tryptophan (Trp) is another potential target for this oxidation. Owing to the presence of 10−3M epidermal albumin which contains one Trp residue, it was tempting to follow the oxidation of this amino acid. Using in vivo and in vitro FT‐Raman spectroscopy, we show for the first time that epidermal Trp is oxidised in patients with vitiligo, yielding 5‐OH‐Trp at 930 cm−1 and other oxidation products (i.e. N‐formyl kynurenine and kynurenine) from indole ring oxidation peaking at 1050 cm−1. On the basis of detailed in vitro results, we could conclude that 5‐OH‐Trp as well as formyl kynurenine and kynurenine are formed via H2O2‐mediated Fenton chemistry. These results once again bring out the strength of non‐invasive in vivo FT‐Raman Spectroscopy in dermatology to follow the effect of oxidative stress in the skin of patients with vitiligo. Copyright © 2008 John Wiley & Sons, Ltd. 相似文献
10.
G. Cardenas‐Jiron D. Leal B. Matsuhiro I. O. Osorio‐Roman 《Journal of Raman spectroscopy : JRS》2011,42(4):870-878
The tetrasaccharide of 1 → 4β‐D‐mannopyranuronate (MM) and the alternating tetrasaccharide of 1 → 4 b‐D‐mannopyranuronate and 1 → 4α‐L‐gulopyranuronate (MG) were analyzed based on density functional theory (DFT) by employing the Gaussian 03 W package. The molecular geometries were fully optimized by using the Becke's three‐parameter hybrid exchange functional combined with Lee–Yang–Parr correlation functional (B3LYP) and using a 6‐31G(d,p) basis set. The calculated IR spectrum of MM presents a band at 1093 cm−1 for C C stretching vibration, which is in good agreement with the experimental observation (1096 cm−1) for the polymannuronate fraction obtained by partial hydrolysis of sodium alginate extracted from the hybrid brown seaweed Lessonia–Macrocystis. The calculated value at 826 cm−1for MM is in close agreement with the experimental value and confirms that this band is characteristic of polymannuronate blocks. Most of the bands in the IR spectrum are also present in the observed Raman spectrum of the polymannuronate fraction. The experimental IR spectrum of heteropolymeric fraction obtained by partial hydrolysis of sodium alginate shows absorbances similar to those calculated for the model tetrasaccharide (MG). Surface‐enhanced Raman scattering (SERS) allows differentiation between the homopolymeric and heteropolymeric fractions of sodium alginate. The SERS spectrum of the heteropolymeric fraction shows an enhanced signal at 731 cm−1which is present in the calculated Raman spectrum of the tetrasaccharide MG at 729 cm−1. This band is assigned to the ring‐breathing deformation of the β‐D‐mannopyranuronate and α‐L‐gulopyranuronate residues. Copyright © 2010 John Wiley & Sons, Ltd. 相似文献
11.
Edyta Podstawka‐Proniewicz Marcin Andrzejak Pawe Kafarski Younkyoo Kim Leonard M. Proniewicz 《Journal of Raman spectroscopy : JRS》2011,42(5):958-979
Four L ‐valine (L ‐Val) phosphonate dipeptides that are potent inhibitors of zinc metalloproteases, namely, L ‐Val‐C(Me)2‐PO3H2 (V1), L ‐Val‐CH(iP)‐PO3H2 (V2), L ‐Val‐CH(iB)‐PO3H2 (V3), and L ‐Val‐C(Me)(iP)‐PO3H2 (V4), are studied by Fourier‐transform infrared (FT‐IR) spectroscopy, Fourier‐transform Raman spectroscopy (FT‐RS), and surface‐enhanced Raman scattering (SERS). The band assignment (wavenumbers and intensities) is made based on (B3LYP/6‐311 + + G**) calculations. Comparison of theoretical FT‐IR and FT‐RS spectra with those of SERS allows to obtain information on the orientation of these dipeptides as well as specific‐competitive interactions of their functionalities with the silver substrate. More specifically, V1 and V4 appear to interact with the silver substrate mainly via a CsgCH3 moiety localized at the NamideCsg(CH3)P molecular fragment. In addition, the POH and isopropyl units of V4 assist in the adsorption process of this molecule. In contrast, the CαNH2 and PO3H− groups of V2 and V3 interact with the silver nanoparticles, whereas their isopropyl and isobutyl fragments seem to be repelled by the silver substrate (except for the CH2 of V3), similar to the Cβ(CH3)2 fragment of L ‐Val for all L ‐Val phosphonate dipeptides investigated in this work. The adsorption mechanism of these molecules onto the colloidal silver surface is also affected by amide bond behavior. Copyright © 2010 John Wiley & Sons, Ltd. 相似文献
12.
J. Hanuza M. Maczka M. Gasior‐Gogowska M. Komorowska M. Kobielarz R. Bdziski S. Szotek K. Maksymowicz K. Hermanowicz 《Journal of Raman spectroscopy : JRS》2010,41(10):1163-1169
The combination of Fourier transform‐Raman spectroscopy and uniaxial tensile tests (in MTS Synergie 100 testing machine) was used to investigate microstructural changes in the secondary protein structure of the aortic wall under different levels of stress. The spectroscopic analysis clearly shows differing tension thresholds for material excised in two directions: circumferential and longitudinal. This is confirmed by the results of macroscopic mechanical analyses. The application of strain does not lead to any noticeable change in the bandwidths of the Raman bands. The stress‐controlled Raman band analysis shows that the modes at 938 cm−1 assigned as Cα C of the α‐helix, 1660 cm−1 amide I (the unordered structure of elastin) and 1668 cm−1 amide I (the collagen triple helix) undergo wavenumber shifting, but the bands at 1004 cm−1 assigned to the phenyl ring breathing mode and 2940 cm−1 to the ν (CH3) and ν (CH2) modes are not affected during the elastic behaviour. A clear correlation between Raman band shifting and the level of mechanical stress has been established. Elastin alone participates in the transmission of low stresses in the circumferential direction, whereas both elastin and collagen take part in the transmission of physiological and higher stresses. Copyright © 2009 John Wiley & Sons, Ltd. 相似文献
13.
J. A. Lima P. T. C. Freire F. E. A. Melo V. Lemos J. Mendes Filho P. S. Pizani 《Journal of Raman spectroscopy : JRS》2008,39(10):1356-1363
Raman spectra of an L ‐methionine (C5H11NO2S) crystal were obtained in the spectral region between 50 and 3200 cm−1 for pressures up to 5 GPa. Pronounced changes of the Raman spectra were observed for bands associated to rocking of CO2−; wagging of CO2−; deformations of CO2−, CH3, and NH3+; and stretching vibrations of SC, CC, CH, CH2, and CH3. Upon decompression to ambient pressure the original Raman spectrum prior to compression is recovered. These modifications were associated to a reversible phase transition undergone by the L ‐methionine crystal at about 2.2 GPa, with a hysteresis of ∼0.8 GPa. Pressure coefficients for most of the internal modes of the crystal are given. Copyright © 2008 John Wiley & Sons, Ltd. 相似文献
14.
Saima Jabeen Trevor J. Dines Stephen A. Leharne Robert Withnall Babur Z. Chowdhry 《Journal of Raman spectroscopy : JRS》2010,41(10):1306-1317
Raman and infrared spectra are reported for rhodanine, 3‐aminorhodanine and 3‐methylrhodanine in the solid state. Comparisons of the spectra of non‐deuterated/deuterated species facilitate discrimination of the bands associated with N H, NH2, CH2 and CH3 vibrations. DFT calculations of structures and vibrational spectra of isolated gas‐phase molecules, at the B3‐LYP/cc‐pVTZ and B3‐PW91/cc‐pVTZ level, enable normal coordinate analyses in terms of potential energy distributions for each vibrational normal mode. The cis amide I mode of rhodanine is associated with bands at ∼1713 and 1779 cm−1, whereas a Raman and IR band at ∼1457 cm−1 is assigned to the amide II mode. The thioamide II and III modes of rhodanine, 3‐aminorhodanine and 3‐methylrhodanine are observed at 1176 and 1066/1078; 1158 and 1044; 1107 and 984 cm−1 in the Raman and at 1187 and 1083; 1179 and 1074; 1116 and 983 cm−1 in the IR spectra, respectively. Copyright © 2010 John Wiley & Sons, Ltd. 相似文献
15.
J. C. Lassgues J. Grondin R. Holomb P. Johansson 《Journal of Raman spectroscopy : JRS》2007,38(5):551-558
The calculated and experimental Raman spectra of the (EMI+)TFSI− ionic liquid, where EMI+ is the 1‐ethyl‐3‐methylimidazolium cation and TFSI− the bis(trifluoromethanesulfonyl)imide anion, have been investigated for a better understanding of the EMI+ and TFSI− conformational isomerism as a function of temperature. Characteristic Raman lines of the planar (p) and non‐planar (np) EMI+ conformers are identified using the reference (EMI+)Br− salt. The anion conformer of C2 symmetry is confirmed to be more stable than the cis (C1) one by 4.5 ± 0.2 kJ mol−1. At room temperature, the population of trans (C2) anions and np cations is 75 ± 2% and 87 ± 4%, respectively. Fast cooling quenches a metastable glassy phase composed of mainly C2 anion conformers and p cation conformers, whereas slow cooling gives a crystalline phase composed of C1 anion conformers and of np cation conformers. Copyright © 2006 John Wiley & Sons, Ltd. 相似文献
16.
Lavinia de Ferri Andrea Lorenzi Pier Paolo Lottici 《Journal of Raman spectroscopy : JRS》2016,47(6):699-705
The hybrid organic–inorganic system Tetra‐ethyl‐ortho‐silicate functionalized with Octyl‐triethoxy‐silane, studied as protective coating for the preservation of historical glasses from the environmental weathering agents, has been characterized by Raman spectroscopy by monitoring the sol‐gel reactions over time through characteristic features in the spectrum. In particular, for the hydrolysis reaction the disappearance of the 653 cm−1 (Si‐O symmetric breathing) and 810 cm−1 (CH2 rocking in Si‐alkoxides) peaks and the growth of the 710 cm−1 band, because of hydrolyzed alkyl‐silane, and of the 881 cm−1 peak (ethanol C–C symmetric stretching) have been checked. Moreover, the condensation reaction can be tracked by the disappearance of the two main peaks of the alcohols at 816 and 881 cm−1, going along with the growth of the broad band between 250 and 500 cm−1 (Si–O–Si symmetric bending) and of the feature at 840 cm−1 (Si–O–Si stretching). At the end of the condensation process the Raman spectrum still displays spectral bands unique to the alkyl chain in Octyl‐triethoxy‐silane, in the 1330–1450 cm−1 and 2725–3000 cm−1 ranges. Copyright © 2016 John Wiley & Sons, Ltd. 相似文献
17.
N. Piluso R. Anzalone M. Camarda A. Severino A. La Magna G. D'Arrigo F. La Via 《Journal of Raman spectroscopy : JRS》2013,44(2):299-306
Micro‐ and nano‐electromechanical systems (MEMS and NEMS) fabricated in 3 C‐SiC are receiving particular attention thanks to the material physical properties: its wide band gap (2.3 eV), its ability to operate at high temperatures, its mechanical strength and its inertness to the exposure in corrosive environments. However, high residual stress (which is normally generated during the hetero‐epitaxial growth process) makes the use of 3 C‐SiC in Si‐based MEMS fabrication techniques very limited leading to a failure of micro‐machined/sensor structures. In this paper, micro‐Raman characterizations and finite‐element modeling (FEM) of microstructures realized on poly and single‐crystal (100) 3 C‐SiC/Si films are performed. Transverse optical (TO) Raman mode analysis reveals the stress relaxation on the free standing structure (796.5 cm−1) respect to the stressed unreleased region (795.7 cm−1). Also, microstructures as cantilever, bridge and planar rotating probe show an intense stress field located around the undercut region. Here, the TO Raman mode undergoes an intense shift, up to 2 cm−1, ascribed to the modification of the Raman stress tensor. Indeed, the generalized axial regime, described by diagonal components of the Raman stress tensor, cannot be applied in this region. Raman maps analysis and FEM simulations show the ‘activation’ of the shear stress, i.e. non‐diagonal components of the stress tensor. The stress‐Raman modes shift correlation, in the case of fully non‐diagonal stress tensors, has been investigated. The aim of future works will be to minimize the stress field generation and the defects density within the epitaxial layer. Copyright © 2012 John Wiley & Sons, Ltd. 相似文献
18.
P. F. Faanha Filho P. T. C. Freire F. E. A. Melo V. Lemos J. Mendes Filho P. S. Pizani D. Z. Rossatto 《Journal of Raman spectroscopy : JRS》2009,40(1):46-51
Raman spectra of a crystal of L ‐leucine, an essential amino acid, were obtained for pressures between 0 and 6 GPa. The results show anomalies at three pressure values, one between 0 and 0.46 GPa, another between 0.8 and 1.46 GPa, and a third at P ∼ 3.6 GPa. The first two anomalies are characterized by the disappearance of lattice modes (which can indicate occurrence of phase transitions), the appearance of several internal modes, or the splitting of modes of high wavenumbers. The changes of internal modes are related to CH and CH3 unit motions as well as hydrogen bonds, as can be inferred from the behavior of bands associated with CO2− moieties. The third anomaly is a discrete change of the slopes of the wavenumber versus pressure plots for most modes observed. Further, decompression to ambient pressure generates the original Raman spectrum, showing that the pressure‐induced anomalies undergone by L ‐leucine crystals are reversible. Copyright © 2008 John Wiley & Sons, Ltd. 相似文献
19.
Josefine Enman Kerstin Ramser Ulrika Rova Kris Arvid Berglund 《Journal of Raman spectroscopy : JRS》2008,39(10):1464-1468
Eritadenine, 2(R),3(R)‐dihydroxy‐4‐(9‐adenyl)‐butyric acid, is a cholesterol‐reducing compound naturally occurring in the shitake mushroom (Lentinus edodes). To identify the unknown Raman spectrum of this compound, pure synthetic eritadenine was examined and the vibrational modes were assigned by following the synthesis pathway. This was accomplished by comparing the known spectra of the starting compounds adenine and D ‐ribose with the spectra of a synthesis intermediate, methyl 5‐(6‐Aminopurin‐9H‐9‐yl)‐2,3‐O‐isopropylidene‐5‐deoxy‐β‐D ‐ribofuranoside (MAIR) and eritadenine. In the Raman spectrum of eritadenine, a distinctive vibrational mode at 773 cm−1 was detected and ascribed to vibrations in the carbon chain, ν(C C). A Raman line that arose at 1212 cm−1, both in the Raman spectrum of MAIR and eritadenine, was also assigned to ν(C C). Additional Raman lines detected at 1526 and at 1583 cm−1 in the Raman spectrum of MAIR and eritadenine were assigned to ν(N C) and a deformation of the purine ring structure. In these cases the vibrational modes are due to the linkage between adenine and the ribofuranoside moiety for MAIR, and between adenine and the carbon chain for eritadenine. This link is also the cause for the disappearance of adenine specific Raman lines in the spectrum of both MAIR and eritadenine. Several vibrations observed in the spectrum of D ‐ribose were not observed in the Raman spectrum of eritadenine due to the absence of the ribose ring structure. In the Raman spectrum of MAIR some of the D ‐ribose specific Raman lines disappeared due to the introduction of methyl and isopropylidene moieties to the ribose unit. With the approach presented in this study the so far unknown Raman spectrum of eritadenine could be successfully identified and is presented here for the first time. Copyright © 2008 John Wiley & Sons, Ltd. 相似文献
20.
G‐quadruplexes (G4s) are four‐stranded DNA structures formed within nucleic acid sequences that are rich in guanines. G4 formation within DNA strands is believed to have significant biological relevance for the control of cell replication and gene expression. Therefore, the development and validation of experimental techniques that can easily and reliably characterize G4 structures under biologically relevant measurement conditions, like Raman spectroscopy, are desirable for G4‐targeted structure based drug design. Here we report Raman and polarized Raman studies of solutions of three oligonucleotides, thrombin binding aptamer (TBA) 5′‐GGTTGGTGTGGTTGG‐3′, human telomeric (HT) 5′‐(TTAGGG)4‐3′, and a modified c‐Myc NHE‐III1 sequence (MycL1) 5′‐TGAGGGTGGGTAGGGTGGGTAA‐3′, which were previously reported to form four distinct intramolecular G4 structures in the presence of Na+ or K+, as determined by NMR. Our results support the previously proposed antiparallel (TBA), antiparallel and hybrid (HT), and parallel with double‐chain reversal (DCR) loop (MycL1) structures. Large sample‐dependent variations in the intensity of bands associated with deoxyribose backbone modes in the 840–930 cm−1 and 1420–1460 cm−1 spectral regions were observed. Most notably, a highly polarized deoxyribose ring symmetric stretch (~930 cm−1) appeared strongly in the solution spectra for HT and TBA, but was very weak or absent in the solution spectrum for MycL1 and the drop deposition (dried sample) spectra for all three oligonucleotides. It is hypothesized that the intensity of this band is likely controlled by furanose ring structure uniformity and/or solvent accessibility to certain nucleotide binding sites. Raman depolarization ratios measured for the G4s in solution were generally very similar to those previously reported for canonical B DNA, with the possible exception of base ring modes that consistently yielded slightly lower depolarization ratios for G4s compared to B DNA. The results further underscore the utility of Raman and polarized Raman spectroscopy for G4 structure elucidation under biologically relevant solution conditions. Copyright © 2015 John Wiley & Sons, Ltd. 相似文献