Stabilization of parallel triplexes by twisted intercalating nucleic acids (TINAs) incorporating 1,2,3-triazole units and prepared by microwave-accelerated click chemistry

A highly efficient method for postsynthetic modification of unprotected oligonucleotides incorporating internal insertions of (R)-1-O-(4-ethynylbenzyl)glycerol has been developed through the application of click chemistry with water-insoluble pyren-1-yl azide and water-soluble benzyl azide and acceleration by microwave irradiation. The twisted intercalating nucleic acids (TINAs) obtained in these reactions, possessing bulged insertions of (R)-3-O-{4-[1-(pyren-1-yl)-1H-1,2,3-triazol-4-yl]benzyl}glycerol (7), formed parallel triplexes with thermal stabilities of 20.0, 34.0, and 40.0 degrees C at pH 7.2 in the cases of one, two, or three insertions of 7, respectively, separated by three nucleic bases. An oligonucleotide with four insertions of 7--each between three nucleic bases in the sequence--was unable to form complexes with complementary single- or double-stranded DNAs, as a result of self-aggregation of the pyrene moieties. This assumption was supported by the formation of a very strong excimer band at 460 nm in the fluorescence spectra. Molecular modeling of the parallel triplex with bulged insertion of the monomer 7 in the triplex-forming oligonucleotide (TFO) showed that only the pyrene moiety was stacking between the bases of the dsDNA, whereas 1,2,3-triazole did not participate in the triplex stabilization. Thermal denaturation studies of the duplexes and triplexes, as well as the fluorescence properties of TINA-triazole 7, are discussed and compared with previous studies on TINA.     

1-, 2-, and 4-ethynylpyrenes in the structure of twisted intercalating nucleic acids: structure, thermal stability, and fluorescence relationship

A postsynthetic, on-column Sonogashira reaction was applied on DNA molecules modified by 2- or 4-iodophenylmethylglycerol in the middle of the sequence, to give the corresponding ortho- and para-twisted intercalating nucleic acids (TINA) with 1-, 2-, and 4-ethynylpyrene residues. The convenient synthesis of 2- and 4-ethynylpyrenes started from the hydrogenolysis of pyrene that has had the sulfur removed and separation of 4,5,9,10-tetrahydropyrene and 1,2,3,6,7,8-hexahydropyrene, which were later converted to the final compounds by successive Friedel-Crafts acetylation, aromatization by 2,3-dichloro-5,6-dicyano-1,4-benzoquinone, and a Vilsmeier-Haack-Arnold transformation followed by a Bodendorf fragmentation. Significant alterations in thermal stability of parallel triplexes and antiparallel duplexes were observed upon changing the attachment of ethynylpyrenes from para to ortho in homopyrimidine TINAs. Thus, for para-TINAs the bulge insertion of an intercalator led to high thermal stability of Hoogsteen-type parallel triplexes and duplexes, whereas Watson-Crick-type duplexes were destabilized. In the case of ortho-TINA, both Hoogsteen and Watson-Crick-type complexes were stabilized. Alterations in the thermal stability were highly influenced by the ethynylpyrene isomers used. This also led to TINAs with different changes in fluorescence spectra depending on the secondary structures formed. Stokes shift of approximately 100 nm was detected for pyren-2-ylethynylphenyl derivatives, whereas values for 1- and 4-ethynylpyrenylphenyl conjugates were 10 and 40 nm, respectively. In contrast with para-TINAs, insertion of two ortho-TINAs opposite each other in the duplex as a pseudo-pair resulted in formation of an excimer band at 505 nm for both 1- and 4-ethynylpyrene analogues, which was also accompanied with higher thermal stability.     

High physiological thermal triplex stability optimization of twisted intercalating nucleic acids (TINA)

The structure of the monomer (R)-1-O-[4-(1-pyrenylethynyl)phenylmethyl]glycerol () in twisted intercalating nucleic acids (TINA) was optimized for stabilizing interactions between the intercalator and surrounding nucleobases when used as a triplex forming oligonucleotide (TFO). Enhancement of pi-pi interactions with nucleobases of the TFO was achieved by increasing the aromatic surface using the (R)-1-O-[4-(1-pyrenylethynyl)naphthylmethyl]glycerol monomer (). Bulge insertion of in the middle of a Hoogsteen-type triplex increased the triplex thermal stability, DeltaT(m) = +2.0 degrees C compared with at pH 7.2. Syntheses and thermal denaturation studies of triplexes and duplexes are described for three novel TINA monomers. The influence of pi-pi interactions, link length and the positioning of the ether in the linker in the TINA derivatives are described.     

Solid-phase synthesis of positively charged deoxynucleic guanidine (DNG) tethering a Hoechst 33258 analogue: triplex and duplex stabilization by simultaneous minor groove binding

Deoxynucleic guanidine (DNG), a DNA analogue in which positively charged guanidine replaces the phosphodiester linkages, tethering to Hoechst 33258 fluorophore by varying lengths has been synthesized. A pentameric thymidine DNG was synthesized on solid phase in the 3' --> 5' direction that allowed stepwise incorporation of straight chain amino acid linkers and a bis-benzimidazole (Hoechst 33258) ligand at the 5'-terminus using PyBOP/HOBt chemistry. The stability of (DNA)(2).DNG-H triplexes and DNA.DNG-H duplexes formed by DNG and DNG-Hoechst 33258 (DNG-H) conjugates with 30-mer double-strand (ds) DNA, d(CGCCGCGCGCGCGAAAAACCCGGCGCGCGC)/d(GCGGCGCGCGCGCTTTTTGGGCCGCGCGCG), and single-strand (ss) DNA, 5'-CGCCGCGCGCGCGAAAAACCCGGCGCGCGC-3', respectively, has been evaluated by thermal melting and fluorescence emission experiments. The presence of tethered Hoechst ligand in the 5'-terminus of the DNG enhances the (DNA)(2).DNG-H triplex stability by a DeltaT(m) of 13 degrees C. The fluorescence emission studies of (DNA)(2).DNG-H triplex complexes show that the DNG moiety of the conjugates bind in the major groove while the Hoechst ligand resides in the A:T rich minor groove of dsDNA. A single G:C base pair mismatch in the target site decreases the (DNA)(2).DNG triplex stability by 11 degrees C, whereas (DNA)(2).DNG-H triplex stability was decreased by 23 degrees C. Inversion of A:T base pair into T:A base pair in the center of the binding site, which provides a mismatch selectively for DNG moiety, decreases the triplex stability by only 5-6 degrees C. Upon hybridization of DNG-Hoechst conjugates with the 30-mer ssDNA, the DNA.DNG-H duplex exhibited significant increase in the fluorescence emission due to the binding of the tethered Hoechst ligand in the generated DNA.DNG minor groove, and the duplex stability was enhanced by DeltaT(m) of 7 degrees C. The stability of (DNA)(2).DNG triplexes and DNA.DNG duplexes is independent of pH, whereas the stability of (DNA)(2).DNG-H triplexes decreases with increase in pH.     

Synthesis of β-pyrrolic-modified porphyrins and their incorporation into DNA

A synthetic methodology for the synthesis of various β-pyrrolic-functionalised porphyrins and their covalent attachment to 2'-deoxyuridine and DNA is described. Palladium(0)-catalysed Sonogashira and copper(I)-catalysed Huisgen 1,3-dipolar cycloaddition reactions were used to insert porphyrins into the structure of 2'-deoxyuridine and DNA. Insertion of a porphyrin into the middle of single-stranded CT oligonucleotides possessing a 5'-terminal run of four cytosines was shown to trigger the formation of pH- and temperature-dependent i-motif structures. Porphyrin insertion also led to the aggregation of single-stranded purine-pyrimidine sequences, which could be dissociated by heating at 90 °C for 5 min. Parallel triplexes and anti-parallel duplexes were formed in the presence of the appropriate complementary strand(s). Depending on the modification, porphyrins were placed in the major and minor grooves of duplexes and were used as bulged intercalating insertions in duplexes and triplexes. In general, the thermal stabilisation of parallel triplexes possessing porphyrin-modified triplex-forming oligonucleotide (TFO) strands was observed, whereas anti-parallel duplexes were destabilised. These results are compared and discussed on the basis of the results of molecular modelling calculations.     

Energetic contributions for the formation of TAT/TAT,TAT/CGC(+), and CGC(+)/CGC(+) base triplet stacks

We used a combination of spectroscopic and calorimetric techniques to determine complete thermodynamic profiles accompanying the folding of a set of triple helices and control duplexes. Specifically, we studied the sequences: d(A(7)C(5)T(7)C(5)T(7)), d(A(6)C(5)T(6)C(5)T(6)), d(A(6)C(5)T(6)), d(AGAGAGAC(5)TCTCTCTC(5)TCTCTCT), d(AGAGAC(5)TCTCTC(5)TCTCT), d(AGAGAC(5)TCTCTC(2)), d(AAGGAC(5)TCCTTC(5)TTCCT), d(AGGAAC(5)TTCCTC(5)TCCTT), and d(GAAAGC(5)CTTTCC(5)CTTTC). Circular dichroism spectroscopy indicated that all triplexes and duplexes are in the "B" conformation. DSC melting experiments revealed that the formation of triplexes is accompanied by a favorable free energy change, which arises from the compensation of a large and favorable enthalpic contribution with an unfavorable entropic contribution. Comparison of the thermodynamic profiles of these triplexes yielded enthalpic contributions of -24 kcal/mol, -23 kcal/mol, and -22 kcal/mol for the formation of TAT/TAT, TAT/CGC(+), and CGC(+)/CGC(+) base triplet stacks, respectively. UV melts as a function of sodium concentration show sodium ions stabilize the triplexes that contain only TAT triplets but destabilize the triplexes that contain CGC(+) triplets. UV melts as a function of pH indicate that the protonation of the third strand and loop cytosines stabilizes the triplexes that contain CGC(+) and TAT triplets, respectively. Our overall results suggest that the triplex to duplex transition of triplexes that contain CGC(+) triplets is accompanied by a release of protons and an uptake of sodium, while their duplex to random coil transition is accompanied by a release of sodium ions. A consequence of this opposite sodium dependence is that their coupled transitions are nearly independent of sodium concentration but are dependent on the experimental pH.     

Synthesis and properties of oligodeoxynucleotides incorporating a conformationally rigid uridine unit having a cyclic structure at the 5'-terminal site

A 2'-O-methyluridylic acid derivative 3 having a cyclic structure linked between the 5-position of the uracil residue and the 5'-phosphate group was synthesized. The NMR analysis suggests that this cyclouridylic acid derivative has exclusively the C3'-endo conformation that is in favor of duplex formation with RNA. Two oligonucleotides ?pc3Um(pT)(9) and pc3Um(pU)(9) incorporating this cyclouridylic acid unit at the 5'-terminal site were synthesized by using the fully protected cyclouridylic acid 3'-phosphoramidite derivative 11 in the solid-phase synthesis. To examine the actual effect of this cyclic structure on the thermal stability of duplexes between the modified oligonucleotides and their complementary oligonucleotides, two oligonucleotides ?pUm(pT)(9) and pUm(pU)(9) having an acyclic structure were also synthesized. As the complementary oligonucleotides, dA(pdA)(9) and A(pA)(9) were used for T(m) experiments with these 5'-terminal modified oligonucleotides. The T(m) values of all the possible duplexes were measured. These results clearly show that the duplex of pc3Um(pT)(9)-A(pA)(9) has a higher T(m) value by 5.5 degrees C than that of A(pA)(9)-T(pT)(9). This is rather significant compared with all other cases. Moreover, the T(m) value of pc3Um(pT)(9)-A(pA)(9) is 4.5 degrees C higher than that of pUm(pT)(9)-A(pA)(9). This result suggests that the cyclic structure can considerably contribute to stabilization of the duplex only in the case of the modified oligomer (DNA) and decaadenylate (RNA).     

5' modification of duplex DNA with a ruthenium electron donor-acceptor pair using solid-phase DNA synthesis

Incorporation of metalated nucleosides into DNA through covalent modification is crucial to measurement of thermal electron-transfer rates and the dependence of these rates with structure, distance, and position. Here, we report the first synthesis of an electron donor-acceptor pair of 5' metallonucleosides and their subsequent incorporation into oligonucleotides using solid-phase DNA synthesis techniques. Large-scale syntheses of metal-containing oligonucleotides are achieved using 5' modified phosporamidites containing [Ru(acac)(2)(IMPy)](2+) (acac is acetylacetonato; IMPy is 2'-iminomethylpyridyl-2'-deoxyuridine) (3) and [Ru(bpy)(2)(IMPy)](2+) (bpy is 2,2'-bipyridine; IMPy is 2'-iminomethylpyridyl-2'-deoxyuridine) (4). Duplexes formed with the metal-containing oligonucleotides exhibit thermal stability comparable to the corresponding unmetalated duplexes (T(m) of modified duplex = 49 degrees C vs T(m) of unmodified duplex = 47 degrees C). Electrochemical (3, E(1/2) = -0.04 V vs NHE; 4, E(1/2) = 1.12 V vs NHE), absorption (3, lambda(max) = 568, 369 nm; 4, lambda(max) = 480 nm), and emission (4, lambda(max) = 720 nm, tau = 55 ns, Phi = 1.2 x 10(-)(4)) data for the ruthenium-modified nucleosides and oligonucleotides indicate that incorporation into an oligonucleotide does not perturb the electronic properties of the ruthenium complex or the DNA significantly. In addition, the absence of any change in the emission properties upon metalated duplex formation suggests that the [Ru(bpy)(2)(IMPy)](2+)[Ru(acac)(2)(IMPy)](2+) pair will provide a valuable probe for DNA-mediated electron-transfer studies.     

Stabilizing or destabilizing oligodeoxynucleotide duplexes containing single 2'-deoxyuridine residues with 5-alkynyl substituents

The 5-position of pyrimidines in DNA duplexes offers a site for introducing alkynyl substituents that protrude into the major groove and thus do not sterically interfere with helix formation. Substituents introduced at the 5-position of the deoxyuridine residue of dU:dA base pairs may stabilize duplexes and reinforce helices weakened by a low G/C content, which would otherwise lead to false negative results in DNA chip experiments. Here we report on a method for preparing oligonucleotides with a 5-alkynyl substituent at a 2'-deoxyuridine residue by on-support Sonogashira coupling involving the fully assembled oligonucleotide. A total of 25 oligonucleotides with 5-alkynyl substituents were prepared. The substituents either decrease the UV melting point of the duplex with the complementary strand or increase it by up to 7.1 degrees C, compared with that of the unmodified control duplex. The most duplex-stabilizing substituent, a pyrenylbutyramidopropyne moiety, is likely to intercalate but does not prevent sequence-specific base pairing of the modified deoxyuridine residue or the neighboring nucleotides. It also increases the signal for a target strand when employed on a small oligonucleotide microarray. The ability to tune the melting point of a DNA dodecamer duplex with a single side chain over a temperature range of >11 degrees C may prove useful when developing DNA sequences for biomedical applications.     

Automated synthesis of 3'-metalated oligonucleotides

We report the first synthesis of a metallonucleoside bound to a solid support and subsequent oligonucleotide synthesis with this precursor. Large-scale syntheses of metal-containing oligonucleotides are achieved using a solid support modified with [Ru(bpy)(2)(impy')](2+) (bpy is 2,2'-bipyridine; impy' is 2'-iminomethylpyridyl-2'-deoxyuridine). A duplex formed with the metal-containing oligonucleotide exhibits superior thermal stability when compared to the corresponding unmetalated duplex (T(m) = 50 degrees C vs T(m) = 48 degrees C). Electrochemical (E(1/2) = 1.3 V vs NHE), absorption (lambda(max) = 480 nm), and emission (lambda(max) = 720 nm, tau = 44 ns, Phi = 0.11 x 10(-)(3)) data for the ruthenium-modified oligonucleotides indicate that the presence of the oligonucleotide does not perturb the electronic properties of the ruthenium complex. The absence of any change in the emission properties upon duplex formation suggests that the [Ru(bpy)(2)(impy)](2+) chromophore will be a valuable probe for DNA-mediated electron-transfer studies. Despite the relatively high Ru(III/II) reduction potential, oxidative quenching of photoexcited [Ru(bpy)(2)(impy)](2+) does not lead to oxidative damage of guanine or other DNA bases.     

Stability of Hoogsteen‐Type Triplexes – Electrostatic Attraction between Duplex Backbone and Triplex‐Forming Oligonucleotide (TFO) Using an Intercalating Conjugate

Syntheses are described for two novel twisted intercalating nucleic acid (TINA) monomers where the intercalator comprises a benzene ring linked to a naphthalimide moiety via an ethynediyl bridge. The intercalators Y and Z have a 2‐(dimethylamino)ethyl and a methyl residue on the naphthalimide moiety, respectively. When used as triplex‐forming oligonucleotides (TFOs), the novel naphthalimide TINAs show extraordinary high thermal stability in Hoogsteen‐type triplexes and duplexes with high discrimination of mismatch strands. DNA Strands containing the intercalator Y show higher thermal triplex stability than DNA strands containing the intercalator Z . This observation can be explained by the ionic interaction of the protonated dimethylamino group under physiological conditions, targeting the negatively charged phosphate backbone of the duplex. This interaction leads to an extra binding mode between the TFO and the duplex, in agreement with molecular‐modeling studies. We believe that this is the first example of an intercalator linking the TFO to the phosphate backbone of the duplex by an ionic interaction, which is a promising tool to achieve a higher triplex stability.     

Spectroscopic characterization of fluorescein- and tetramethylrhodamine-labeled oligonucleotides and their complexes with a DNA template

We measured absorption and emission spectra, fluorescence quantum yield, anisotropy, fluorescence resonance energy transfer (FRET), and melting temperature to characterize fluorescein- and tetramethylrhodamine (TMR)-labeled oligonucleotides in solution and when hybridized to a common DNA template. Upon hybridization to the template, both the absorption and emission spectra of TMR-labeled duplexes exhibited a shift with respect to those of labeled oligonucleotides, depending on the location of the TMR on the oligonucleotide. Measurements of quantum yield, anisotropy, and melting temperature indicated that TMR interacted with nucleotides within the duplexes in the order (T1>T5>T11, T16) that the oligonucleotide with TMR labeled at the 5' end (T1) is stronger than that labeled at position 5 from the 5' end (T5), which is also stronger than those labeled at the positions, 11 and 16, from the 5' end (T11, T16). In the case of the duplex formed between T1 and the template, fluorescence quenching was observed, which is attributed to the interaction between the dye molecule and guanosines located at the single-stranded portion of the template. A two-state model was suggested to describe the conformational states of TMR in the duplex. The melting temperatures of the four FRET complexes show the same pattern as those of TMR-labeled duplexes. We infer that the interactions between TMR and guanosine persist in the FRET complexes. This interaction may bring the donor and the acceptor molecules closely together, which could cause interaction between the two dye molecules shown in absorbance measurements of the FRET complexes.     

The C(8)-(2'-deoxy-beta-D-ribofuranoside) of 7-deazaguanine: synthesis and base pairing of oligonucleotides with unusually linked nucleobases

The 7-deazaguanine (2-aminopyrrolo[2,3-d]pyrimidin-4-one) C(8)-(2'-deoxy-beta-D-ribofuranoside) (6b), which possesses an unusual glycosylation site, was synthesized and incorporated in oligonucleotides. The oligonucleotides were prepared by solid-phase synthesis using phosphoramidite chemistry and were hybridized to form duplex DNA. Compound 6b is able to form base pairs with 2'-deoxy-5-methylisocytidine (m(5)isoC(d)) in oligonucleotide duplexes with antiparallel chain orientation and with dC in parallel duplex DNA. Thus, the C(8)-nucleoside 6b shows a similar base recognition as 2'-deoxyisoguanosine but not as 2'-deoxyguanosine. This indicates that the nucleic acid recognition not only depends on the donor-acceptor pattern of the nucleobase but is influenced by the glycosylation site. Base pairs of compound 6b formed with canonical and modified nucleosides are proposed.     

Synthesis and properties of RNA analogues having amides as interuridine linkages at selected positions

Oligoribonucleotide analogues having amide internucleoside linkages (AM1: 3'-CH(2)CONH-5' and AM2: 3'-CH(2)NHCO-5') at selected positions have been synthesized and the thermal stability of duplexes formed by these analogues with complementary RNA fragments has been evaluated by UV melting experiments. Two series of oligomers with either 2'-OH or 2'-OMe vicinal to the amide linkages were studied. Monomeric synthons (3' and 5'-C amines and carboxylic acids) were synthesized as follows: For synthesis of the AM1 analogue, the known sequence of radical allylation followed by the cleavage of the double bond was adopted. For synthesis of the AM2 analogue, novel routes via addition of nitromethane followed by conversion of the nitro function to either amino or carboxyl groups were developed. Coupling of monomeric amines and carboxylic acids followed by protecting group manipulation and phosphonylation gave dimeric 3'-hydrogenphosphonate building blocks for oligonucleotide synthesis. Monomeric model compounds having 3'-amide and 2'-OH or 2'-OMe groups were also prepared and their conformational equilibrium was determined by (1)H NMR. The AM1 and AM2 models showed equal preferences for the North conformers (at 40 degrees C, 88-89% with 2'-OH, and 92-93% with 2'-OMe). At physiological salt concentration (0.1 M NaCl) the duplexes between AM1 modified oligonucleotides and RNA had stability similar to unmodified RNA-RNA duplexes (Delta t(m)= -0.2 to +0.7 degrees C per modification). However, the AM2 modification resulted in substantial stabilization of duplexes: Delta t(m)= +1 to +2.4 degrees C per modification compared to all RNA. A 2'-O-methyl vicinal to the AM2 linkage further increased the duplex stability. Our results suggest that RNA analogues having amide internucleoside bonds are very promising candidates for medicinal applications.     

2'-O-[2-(guanidinium)ethyl]-modified oligonucleotides: stabilizing effect on duplex and triplex structures

[structure: see text] Oligonucleotides with a novel 2'-O-[2-(guanidinium)ethyl] (2'-O-GE) modification have been synthesized using a novel protecting group strategy for the guanidinium group. This modification enhances the binding affinity of oligonucleotides to RNA as well as duplex DNA (DeltaT(m) 3.2 degrees C per modification). The 2'-O-GE modified oligonucleotides exhibited exceptional resistance to nuclease degradation. The crystal structure of a palindromic duplex formed by a DNA oligonucleotide with a single 2'-O-GE modification was solved at 1.16 A resolution.     

Structural studies of LNA:RNA duplexes by NMR: conformations and implications for RNase H activity

We have used NMR and CD spectroscopy to study the conformations of modified oligonucleotides (locked nucleic acid, LNA) containing a conformationally restricted nucleotide (T(L)) with a 2'-O,4'-C-methylene bridge. We have investigated two LNA:RNA duplexes, d(CTGAT(L)ATGC):r(GCAUAUCAG) and d(CT(L)GAT(L)AT(L)GC):r(GCAUAUCAG), along with the unmodified DNA:RNA reference duplex. Increases in the melting temperatures of +9.6 degrees C and +8.1 degrees C per modification relative to the unmodified duplex were observed for these two LNA:RNA sequences. The three duplexes all adopt right-handed helix conformations and form normal Watson-Crick base pairs with all the bases in the anti conformation. Sugar conformations were determined from measurements of scalar coupling constants in the sugar rings and distance information derived from 1H-1H NOE measurements; all the sugars in the RNA strands of the three duplexes adopt an N-type conformation (A-type structure), whereas the sugars in the DNA strands change from an equilibrium between S- and N-type conformations in the unmodified duplex towards more of the N-type conformation when modified nucleotides are introduced. The presence of three modified T(L) nucleotides induces drastic conformational shifts of the remaining unmodified nucleotides of the DNA strand, changing all the sugar conformations except those of the terminal sugars to the N type. The CD spectra of the three duplexes confirm the structural changes described above. On the basis of the results reported herein, we suggest that the observed conformational changes can be used to tune LNA:RNA duplexes into substrates for RNase H: Partly modified LNA:RNA duplexes may adopt a duplex structure between the standard A and B types, thereby making the RNA strand amenable to RNase H-mediated degradation.     

Recognition properties of donor- and acceptor-modified biphenyl-DNA

The recognition properties of DNA duplexes containing single or triple incorporations of eight different donor-modified (OMe, NH(2)) and acceptor-modified (NO(2)) biphenyl residues as base replacements in opposite positions were probed by UV-melting and by CD and fluorescence spectroscopy. We found a remarkable dependence of duplex stability on the natures of the substituents (donor vs. acceptor). The stabilities of duplexes with one biphenyl pair increase in the order donor/donor < acceptor/donor < acceptor/acceptor substitution. The most stable biphenyl pairs stabilize duplexes by up to 6 degrees C in T(m). In duplexes with three consecutive biphenyl pairs the stability increases in the inverse order (acceptor/acceptor < donor/acceptor < donor/donor) with increases in T(m), relative to an unmodified duplex, of up to 10 degrees C. A thermodynamic analysis, combined with theoretical calculations of the physical properties of the biphenyl substituents, suggests that in duplexes with single biphenyl pairs the affinity is dominated by electrostatic forces between the biphenyl/nearest neighbor natural base pairs, whereas in the triple-modified duplexes the increase in thermal stability is predominantly determined by hydrophobic interactions of the biphenyl residues with each other. Oligonucleotides containing amino biphenyl residues are fluorescent. Their fluorescence is largely quenched when they are paired with themselves or with nitrobiphenyl-containing duplex partners.     

Mispair-aligned N3T-alkyl-N3T interstrand cross-linked DNA: synthesis and characterization of duplexes with interstrand cross-links of variable lengths

Therapeutic bifunctional alkylating agents generate interstrand cross-links in duplex DNA. As part of our continuing studies on DNA duplexes that contain alkyl interstrand cross-links, we have synthesized a cross-link that bridges the N(3) positions of a mismatched thymidine base pair. This cross-link, which is similar to the N(3)C-alkyl-N(3)C cross-link that has been observed between mismatched cytosine base pairs, was introduced by first incorporating a cross-linked phosphoramidite unit at the 5'-end of an oligonucleotide chain. Fully cross-linked duplexes were then synthesized using an orthogonal approach to selectively remove protecting groups, thus allowing construction of the cross-linked duplex via conventional solid-phase oligonucleotide synthesis. Short DNA duplexes with alkyl cross-links of various lengths (two, four, and seven methylene units) were prepared, and their physical properties were studied via UV thermal denaturation and circular dichroism spectroscopy. These linkers were found to stabilize the duplexes by 37, 31, and 16 degrees C for the two-, four-, and seven-carbon linkers, respectively, relative to a non-cross-linked duplex. Circular dichroism spectra suggested that these lesions induce very little deviation in the global structure relative to the non-cross-linked duplex DNA control. Molecular models show that the two-carbon cross-link spans the distance between the N(3) atoms of the T-T mismatch without perturbing the helix structure, whereas the longer linkers, particularly the seven-carbon linker, tend to push the thymines apart, creating a local distortion. This perturbation may account for the lower thermal stability of the seven-carbon versus two-carbon cross-linked duplex.     

Calorimetric unfolding of intramolecular triplexes: length dependence and incorporation of single AT --> TA substitutions in the duplex domain

DNA triplexes have been the subject of great interest due to their ability to interfere with gene expression. The inhibition of gene expression involves the design of stable triplexes under physiological conditions; therefore, it is important to have a clear understanding of the energetic contributions controlling their stability. We have used a combination of UV spectroscopy and differential scanning calorimetric (DSC) techniques to investigate the unfolding of intramolecular triplexes, d(A(n)C5T(n)C5T(n)), where n is 5-7, 9, and 11, and related triplexes with a single AT --> TA substitution in their duplex stem. Specifically, we obtain standard thermodynamic profiles for the unfolding of each triplex in buffer solutions containing 0.1 M or 1 M NaCl. The triplexes unfold in monophasic or biphasic transitions (triplex --> duplex --> coil) depending on the concentration of salt used and position of the substitution, and their transition temperatures are independent of strand concentration. The DSC curves of the unsubstituted triplexes yielded an unfolding heat of 13.9 kcal/mol for a TAT/TAT base-triplet stack and a heat capacity of 505 cal/ degrees C.mol. The incorporation of a single substitution destabilizes triplex formation (association of the third strand) to a larger extent in 0.1 M NaCl, and the magnitude of the effects also depends on the position of the substitution. The combined results show that a single AT --> TA substitution in a homopurine/homopyrimidine duplex does not allow triplex formation of the neighboring five TAT base triplets, indicating that the in vivo formation of triplexes, such as H-DNA, is exclusive to homopurine/homopyrimidine sequences.     

pH‐Independent Recognition of the dG ⋅ dC Base Pair in Triplex DNA: 9‐Deazaguanine N7‐(2′‐Deoxyribonucleoside) and Halogenated Derivatives Replacing Protonated dC

Triplex-forming oligonucleotides (TFOs) containing 9-deazaguanine N⁷-(2′-deoxyribonucleoside) 1a and halogenated derivatives 1b,c were synthesized employing solid-phase oligonucleotide synthesis. For that purpose, the phosphoramidite building blocks 5a – c and 8a – c were synthesized. Multiple incorporations of 1a – c in place of dC were performed within TFOs, which involved the sequence of five consecutive 1a – c ⋅ dG ⋅ dC triplets as well as of three alternating 1a – c ⋅ dG ⋅ dC and dT ⋅ dA ⋅ dT triplets. These TFOs were designed to bind in a parallel orientation to the target duplex. Triplex forming properties of these oligonucleotides containing 1a – c in the presence of Na⁺ and Mg²⁺ were studied by UV/melting-curve analysis and confirmed by circular-dichroism (CD) spectroscopy. The oligonucleotides containing 1a in the place of dC formed stable triplexes at physiological pH in the case of sequence of five consecutive 1a ⋅ dG ⋅ dC triplets as well as three alternating 1a – c ⋅ dG ⋅ dC and dT ⋅ dA ⋅ dT triplets. The replacement of 1a by 9-halogenated derivatives 1b,c further enhanced the stability of DNA triplexes. Nucleosides 1a – c also stabilized duplex DNA.