A methodology for radiolabeling of the endocannabinoid 2-arachidonoylglycerol (2-AG)

The metabolic intermediate and endocannabinoid signaling lipid 2-arachidonoylglycerol (2-AG) has not been readily labeled, primarily because of its instability toward rearrangement. We now detail a synthetic method that easily gives tritiated 2-AG from [5,6,8,9,11,12,14,15-(3)H(N)]arachidonic acid in two steps. We utilized a short chain 1,3-diacylglycerol and proceeded through the "structured lipid" [5',6',8',9',11',12',14',15'-(3)H(N)]2-arachidonoyl-1,3-dibutyrylglycerol, a triacylglycerol that was conveniently deprotected in ethanol with acrylic beads containing Candida antarctica lipase B to give [5',6',8',9',11',12',14',15'-(3)H(N)]2-arachidonoylglycerol ([(3)H]2-AG). The flash chromatographic separation necessary to isolate the labeled 2-acylglycerol [(3)H]2-AG resulted in only 4% of the rearrangement byproducts that have been a particular problem with previous methodologies. This reliable "kit" method to prepare the radiolabeled endocannabinoid as needed gave tritiated 2-arachidonoylglycerol [(3)H]2-AG with a specific activity of 200 Ci/mmol for enzyme assays, metabolic studies, and tissue imaging. It has been run on unlabeled materials on over 10 mg scales and should be generally applicable to other 2-acylglycerols.     

The mechanism of cyclic nucleotide hydrolysis in the phosphodiesterase catalytic site

The cyclic nucleotide phosphodiesterase superfamily of enzymes (PDEs) catalyzes the stereospecific hydrolysis of the second messengers adenosine and guanosine 3',5'- cyclic monophosphate (cAMP, cGMP) to produce 5'-AMP and 5'-GMP, respectively. The PDEs are targets of high-throughput screening to determine selective inhibitors for a variety of therapeutic purposes. The catalytic pocket where the hydrolysis takes place is a highly conserved region and has several residues which are absolutely conserved across the PDE families. In this study, we consider a model cyclic substrate in which the adenine/guanine base has been replaced with a hydrogen atom, and we present results of a quantum computational investigation of the hydrolysis reaction as it occurs within the PDE catalytic site using the ONIOM hybrid (B3LYP/6-31g(d):PM3) method. We characterize the bound substrate, the bound hydrolyzed product, and the transition state which connects them for our model cyclic substrate placed in a truncated model of the PDE4D2 catalytic site. We address the role that the conserved histidine proximal to the bimetal system of the catalytic site, along with its conserved glutamine partner, plays in the generation of the hydroxide nucleophile. Our study provides computational evidence for several key features of the cAMP/cGMP hydrolysis mechanism as it occurs within the protein environment across the PDE superfamily.     

One-pot two-step enzymatic coupling of pyrimidine bases to 2-deoxy-D-ribose-5-phosphate. A new strategy in the synthesis of stable isotope labeled deoxynucleosides

The enzymatic synthesis of thymidine from 2-deoxy-D-ribose-5-phosphate is achieved, in a one-pot two-step reaction using phosphoribomutase (PRM) and commercially available thymidine phosphorylase (TP). In the first step the sugar-5-phosphate is enzymatically rearranged to alpha-2-deoxy-D-ribose-1-phosphate. Highly active PRM is easily obtained from genetically modified overproducing E. coli cells (12,000 units/84 mg protein) and is used without further purification. In the second step thymine is coupled to the sugar-1-phosphate. The thermodynamically unfavorable equilibrium is shifted to the product by addition of MnCl(2) to precipitate inorganic phosphate. In this way the overall yield of the beta-anomeric pure nucleoside increases from 14 to 60%. In contrast to uracil, cytosine is not accepted by TP as a substrate. Therefore, 2'-deoxy-cytidine is obtained by functional group transformations of the enzymatically prepared 2'-deoxy-uridine. The method has been demonstrated by the synthesis of [2',5'-(13)C(2)]- and [1',2',5'-(13)C(3)]thymidine as well as [1',2',5'-(13)C(3)]2'-deoxyuridine and [3',4'-(13)C(2)]2'-deoxycytidine. In addition the nucleoside bases thymine and uracil are tetralabeled at the (1,3-(15)N(2),2,4-(13)C(2))-atomic positions. All compounds are prepared without any scrambling or dilution of the labeled material and are thus obtained with a very high isotope enrichment (96-99%). In combination with the methods that have been developed earlier it is concluded that each of the (13)C- and (15)N-positions and combination of positions of the pyrimidine deoxynucleosides can be efficiently labeled starting from commercially available and highly (13)C- or (15)N-enriched formaldehyde, acetaldehyde, acetic acid, potassium cyanide, methylamine hydrochloride, and ammonia.     

The influence of chloro-substituent sites of hexachlorobiphenyl on the respiration of rat liver mitochondria.

The actions of three hexachlorobiphenyls (HCBs) 2,3,4,2',3',4'-, 2,3,4,3',4',5'- and 3,4,5,3',4',5'-HCBs, on the respiration of rat liver mitochondria with succinate as the substrate were compared, and the effect of chloro-substitution sites in HCB on the respiration was examined. 2,3,4,2',3',4'-HCB strongly inhibited both state 3 and 2,4-dinitrophenol (DNP)-stimulated respiration with 50% inhibition dose of 52 and 54 microM for state 3 and DNP-stimulated respiration, respectively. The inhibitory action of 2,3,4,3',4',5'-HCB on both respiration was approximately half as potent as that of 2,3,4,2',3',4'-HCB. On the other hand, 3,4,5,3',4',5'-HCB did not inhibit any respiration at all. These results indicate that both inside (ortho) and outside (meta or para) positions in each phenyl ring of the biphenyl molecule should be replaced with chlorines for HCB to be an effective inhibitor. Either the actual position of chloro-substituent or steric conformation caused by its substitution or both can be considered as factors affecting the inhibition. On the basis of the conformational energy, calculated by AM1 (Austin model 1) method, with increases in chlorine number in ortho position, HCB molecule became angulated. Furthermore, calculated probability of the conformation distribution for HCB indicated that the probability of nonplanarity was higher for effective HCB than for less effective HCB. These structural features suggest the significance of steric conformation as well as chloro-substituent sites in determining the inhibitory ability of HCB.(ABSTRACT TRUNCATED AT 250 WORDS)     

Rational modification of a selection strategy leads to deoxyribozymes that create native 3'-5' RNA linkages

We previously used in vitro selection to identify several classes of deoxyribozymes that mediate RNA ligation by attack of a hydroxyl group at a 5'-triphosphate. In these reactions, the nucleophilic hydroxyl group is located at an internal 2'-position of an RNA substrate, leading to 2',5'-branched RNA. To obtain deoxyribozymes that instead create linear 3'-5'-linked (native) RNA, here we strategically modified the selection approach by embedding the nascent ligation junction within an RNA:DNA duplex region. This approach should favor formation of linear rather than branched RNA because the two RNA termini are spatially constrained by Watson-Crick base pairing during the ligation reaction. Furthermore, because native 3'-5' linkages are more stable in a duplex than isomeric non-native 2'-5' linkages, this strategy is predicted to favor the formation of 3'-5' linkages. All of the new deoxyribozymes indeed create only linear 3'-5' RNA, confirming the effectiveness of the rational design. The new deoxyribozymes ligate RNA with k(obs) values up to 0.5 h(-1) at 37 degrees C and 40 mM Mg2+, pH 9.0, with up to 41% yield at 3 h incubation. They require several specific RNA nucleotides on either side of the ligation junction, which may limit their practical generality. These RNA ligase deoxyribozymes are the first that create native 3'-5' RNA linkages, which to date have been highly elusive via other selection approaches.     

RHYTHMIC OSCILLATION OF CYCLIC 3',5'AMP AND -GMP CONCENTRATION AND STIMULATION OF FLOWERING BY CYCLIC 3',5'-GMP IN Lemna paucicostata 381

Abstract— Rhythmic oscillation of the concentration of cyclic 3',5'-AMP and -GMP in a short day plant, Lemna paucicostata 381 in continuous darkness was detected after 2 cycles of 12 h dark and 12 h light entrainment. Cyclic 3',5'-AMP and -GMP, extracted from whole plant showed parallel oscillations in their concentrations for initial 36 h in continuous darkness and the oscillation in the concentration of cyclic 3',5'-AMP was roughly circadian. Their concentrations decreased during the initial 12 h (subjective night) and increased during 12 to 28 h. Exogenous addition of 2 μ.M of cyclic 3',5'-GMP or the dibutyryl derivative of it stimulated floral induction by 20 to 30%, when the plants were grown under 12 h light and 12 h dark regime. Cyclic 3',5'-AMP or the dibutyryl derivative of it showed little effect on flowering.     

Ion-exchange separation of nucleic acid constituents by high-performance liquid chromatography

The high-performance liquid chromatographic separation of a large variety of nucleic acid constituents on a silica-based, weak-anion exchange column was accomplished. Using this technique it was possible to achieve some relatively difficult separations, such as the separation of 2'-, 3'-, and 5'-AMP, and the separation of a mixture of ribo- and deoxyribo-nucleosides and -nucleotides. A number of other separations are demonstrated by isocratic or gradient elution. These include the separation of a mixture of nucleoside monophosphates, the separation of a mixture of nucleoside mono-, di-, and triphosphates, the separation of a mixture of nucleosides and bases, and the separation of a mixture of nucleotide oligomers. These chromatographic separations were accomplished using relatively simple experimental procedures at ambient temperatures and involved relatively short analysis times. Excellent separations were obtained, in most cases, by adjustment of buffer concentration and pH, or by addition of an organic modifier. In some cases, it was necessary to use gradient elution to achieve optimum resolution.     

Trinuclear copper(II) complex showing high selectivity for the hydrolysis of 2'-5' over 3'-5' for UpU and 3'-5' over 2'-5' for ApA ribonucleotides

The cooperative action of multiple Cu(II) nuclear centers is shown to be effective and selective in the hydrolysis of 2'-5' and 3'-5' ribonucleotides. Reported herein is the specific catalysis by two trinuclear Cu(II) complexes of L3A and L3B. Pseudo first-order kinetic studies reveal that the L3A trinuclear Cu(II) complex effects hydrolysis of Up(2'-5')U with a rate constant of 28 x 10(-)(4) min(-)(1) and Up(3'-5')U with a rate constant of 0.5 x 10(-)(4) min(-)(1). The hydrolyses of Ap(3'-5')A and Ap(2'-5')A proceed with rate constants of 24 x 10(-)(4) min(-)(1) and 0.5 x 10(-)(4) min(-)(1) respectively. The L3A trinuclear Cu(II) complex demonstrates high specificity for Up(2'-5')U and Ap(3'-5')A. Similar studies with the more rigid L3B trinuclear Cu(II) complex shows no selectivity and yields lower rate constants for hydrolysis. The selectivity observed with the L3A ligand is attributed to the geometry of the ligand-bound diribonucleotide which ultimately dictates the proximity of the attacking hydroxyl and the phosphoester to a Cu(II) center for activation and subsequent hydrolysis.     

Distance dependence of electron transfer in rigid,cofacially compressed,pi-stacked porphyrin-bridge-quinone systems

The electron-transfer (ET) dynamics of a series of unusually rigid pi-stacked porphyrin-quinone (P-Q) systems, in which sub-van der Waals interplanar distances separate juxtaposed porphyryl, aromatic bridge, and quinonyl components of these assemblies, are reported. The photoinduced charge separation (CS) and thermal charge recombination (CR) ET reactions of [5-[8'-(2',5'-benzoquinonyl)-1'-naphthyl]-10,20-diphenylporphinato]zinc(II) (1a-Zn), [5-[8'-(4'-[8'"-(2'"',5'"'-benzoquinonyl)-1'"-naphthyl]-1'-phenyl)-1'-naphthyl]-10,20-diphenylporphinato]zinc(II) (2a-Zn), and [5-(8'-[4'-(8'"-[4'"'-(8'"-[2'"',5'"'-benzoquinonyl]-1'"-naphthyl)-1'"'-phenyl]-1'"-naphthyl)-1'-phenyl]-1'-naphthyl)-10,20-diphenylporphinato]zinc(II) (3a-Zn) in CH(2)Cl(2) were investigated by pump-probe transient absorption spectroscopy. Analyses of these data show that the phenomenological ET distance dependence (beta) for both the CS and CR reactions in these systems is soft (beta(CS) = 0.43 A(-1); beta(CR) = 0.35 +/- 0.16 A(-1)). This work demonstrates that simple aromatic building blocks such as benzene, which are characterized by highly stabilized filled molecular orbitals and large HOMO-LUMO gaps, can provide substantial D-A electronic coupling when organized within a pi-stacked structural motif that features a modest degree of arene-arene interplanar compression.     

Study on the mechanism of interferon action (XI)--Effect of pppA2'p5'A on the level of cAMP and cGMP in macrophages

In this paper, the increase of cellular cAMP and cGMP levels in macrophages induced by ppA2'p5' A2'p5'A (briefly 2'-5'P3A3) is first reported. The optimal concentration of 2'-5' P3A3 for the elevation of cellular cGMP to the highest level is 10(-7)-10(-6) mol/L, while that for cAMP is 10(-7) mol/L. The time for cGMP to reach its peak value is 15 min and that for cAMP is 2 h, when the cells are treated with 2'-5' P3A3 at 10(-7) mol/L, which is the optimal concentration for developing biological effect of macrophages (phagocytosis). These results suggest that cGMP and cAMP may be related to, or may be the mediators for, 2'-5'P3A3 action.     

Deoxyribozymes with 2'-5' RNA ligase activity

In vitro selection was used to identify deoxyribozymes that ligate two RNA substrates. In the ligation reaction, a 2'-5' RNA phosphodiester linkage is created from a 2',3'-cyclic phosphate and a 5'-hydroxyl group. The new Mg(2+)-dependent deoxyribozymes provide 50-60% yield of ligated RNA in overnight incubations at pH 7.5 and 37 degrees C, and they afford 40-50% yield in 1 h at pH 9.0 and 37 degrees C. Various RNA substrate sequences may be joined by simple Watson-Crick covaration of the DNA binding arms that interact with the two RNA substrates. The current deoxyribozymes have some RNA substrate sequence requirements at the nucleotides immediately surrounding the ligation junction (either UAUA GGAA or UAUN GGAA, where the arrow denotes the ligation site and N equals any nucleotide). One of the new deoxyribozymes was used to prepare by ligation the Tetrahymena group I intron RNA P4-P6 domain, a representative structured RNA. Nondenaturing gel electrophoresis revealed that a 2'-5' linkage between nucleotides A233 and G234 of P4-P6 does not disrupt its Mg(2+)-dependent folding (DeltaDeltaG degrees ' < 0.2 kcal/mol). This demonstrates that a 2'-5' linkage does not necessarily interfere with structure in a folded RNA. Therefore, these non-native linkages may be acceptable in modified RNAs when structure/function relationships are investigated. Deoxyribozymes that ligate RNA should be particularly useful for preparing site-specifically modified RNAs for studies of RNA structure, folding, and catalysis.     

Transition-state structure of human 5'-methylthioadenosine phosphorylase

Kinetic isotope effects (KIEs) and computer modeling using density functional theory were used to approximate the transition state of human 5'-methylthioadenosine phosphorylase (MTAP). KIEs were measured on the arsenolysis of 5'-methylthioadenosine (MTA) catalyzed by MTAP and were corrected for the forward commitment to catalysis. Intrinsic KIEs were obtained for [1'-(3)H], [1'-(14)C], [2'-(3)H], [4'-(3)H], [5'-(3)H(2)], [9-(15)N], and [Me-(3)H(3)] MTAs. The primary intrinsic KIEs (1'-(14)C and 9-(15)N) suggest that MTAP has a dissociative S(N)1 transition state with its cationic center at the anomeric carbon and insignificant bond order to the leaving group. The 9-(15)N intrinsic KIE of 1.039 also establishes an anionic character for the adenine leaving group, whereas the alpha-primary 1'-(14)C KIE of 1.031 indicates significant nucleophilic participation at the transition state. Computational matching of the calculated EIEs to the intrinsic isotope effects places the oxygen nucleophile 2.0 Angstrom from the anomeric carbon. The 4'-(3)H KIE is sensitive to the polarization of the 3'-OH group. Calculations suggest that a 4'-(3)H KIE of 1.047 is consistent with ionization of the 3'-OH group, indicating formation of a zwitterion at the transition state. The transition state has cationic character at the anomeric carbon and is anionic at the 3'-OH oxygen, with an anionic leaving group. The isotope effects predicted a 3'-endo conformation for the ribosyl zwitterion, corresponding to a H1'-C1'-C2'-H2' torsional angle of 33 degrees. The [Me-(3)H(3)] and [5'-(3)H(2)] KIEs arise predominantly from the negative hyperconjugation of the lone pairs of sulfur with the sigma (C-H) antibonding orbitals. Human MTAP is characterized by a late S(N)1 transition state with significant participation of the phosphate nucleophile.     

Purification method for the isolation of monophosphate nucleotides from Champagne wine and their identification by mass spectrometry

Monophosphate nucleotides are difficult to identify in Champagne wine because they are present in small concentrations in a complex mixture. A method for the isolation, separation and identification of reference compounds, which achieved on average 79% recovery (except for cytidine derivatives), was developed and applied to wine. Some monophosphate nucleotides were then isolated from a Champagne wine aged on lees for 8 years, by ultrafiltration followed by a semi-preparative HPLC step using a strong anion-exchange column. The fraction obtained was subjected to HPLC in a reversed-phase column to remove the salt previously introduced, before identification of compounds by HPLC coupled to a mass spectrometer. For the first time in wine, 5'-IMP, 5'-AMP, 5'-CMP, 5'-GMP, 5'-UMP and the 3'- and/or 2'-isomers of the four latter compounds were identified by comparing their HPLC and electrospray ionization mass spectrometry data with those of reference nucleotides.     

Trinuclear Metal Complexes Based on 1,10-Phenanthroline Derivates as Catalysts for Cleavage of a RNA-Model Substrate

Two multidentate ligands 2,9-di[6'-(2″-hydroxyl-3″-methoxyphenyl)-n-2',5'-diazahexyl]-1,10-phenanthroline(LA)and 2,9-di(6'-α-phenol-n-2',5'-diazahexyl)-1,10-phenanthroline(LB)were synthesized and fully characterized.Protonation of the ligands and the stability of the complexes of the ligands with divalent metal ions were investigated.The trinuclear metal complexes [Cu(Ⅱ)and Zn(Ⅱ)] of the ligands were studied,as catalysts,for the transphosphorylation of the RNA-model substrate 2-hydroxypropyl-p-nitrophenyl phosphate(HPNP).The second-order rate constants of HPNP-hydrolysis catalyzed by M3L and M3LH-1 were obtained,which indicated that Zn3LBH-1 was the most efficient catalyst among them.The proposed mechanisms included the activation of the substrate via binding to the metal ions and intramolecular nucleophilic attack by the deprotonated C2-hydroxyl of HPNP.     

Nonenzymatic, template-directed ligation of oligoribonucleotides is highly regioselective for the formation of 3'-5' phosphodiester bonds

We have found that nonenzymatic, template-directed ligation reactions of oligoribonucleotides display high selectivity for the formation of 3'-5' rather than 2'-5' phosphodiester bonds. Formation of the 3'-5'-linked product is favored regardless of the metal ion catalyst or the leaving group, and for several different ligation junction sequences. The degree of selectivity depends on the leaving group: the ratio of 3'-5'- to 2'-5'-linked products was 10-15:1 when the 5'-phosphate was activated as the imidazolide, and 60-80:1 when the 5'-phosphate was activated by the formation of a 5'-triphosphate. Comparison of oligonucleotide ligation reactions with previously characterized single nucleotide primer extension reactions suggests that the strong preference for 3'-5'-linkages in oligonucleotide ligation is primarily due to occurence of ligation within the context of an extended Watston-Crick duplex. The ability of RNA to correctly self-assemble by template-directed ligation is an intrinsic consequence of its chemical structure and need not be imposed by an external catalyst (i.e., an enzyme polymerase); RNA therefore provides a reasonable structural basis for a self-replicating system in a prebiological world.     

Acid/azole complexes as highly effective promoters in the synthesis of DNA and RNA oligomers via the phosphoramidite method

The utility of various kinds of acid salts of azole derivatives as promoters for the condensation of a nucleoside phosphoramidite and a nucleoside is investigated. Among the salts, N-(phenyl)imidazolium triflate, N-(p-acetylphenyl)imidazolium triflate, N-(methyl)benzimidazolium triflate, benzimidazolium triflate, and N-(phenyl)imidazolium perchlorate have shown extremely high reactivity in a liquid phase. These reagents serve as powerful activators of deoxyribonucleoside 3'-(allyl N,N-diisopropylphosphoramidite)s or 3'-(2-cyanoethyl N,N-diisopropylphosphoramidite)s employed in the preparation of deoxyribonucleotides, and 3'-O-(tert-butyldimethylsilyl)ribonucleoside 2'-(N,N-diisopropylphosphoramidite)s or 2'-O-(tert-butyldimethylsilyl)ribonucleoside 3'-(N,N-diisopropylphosphoramidite)s used for the formation of 2'-5' and 3'-5' internucleotide linkages between ribonucleosides, respectively. The azolium salt has allowed smooth and high-yield condensation of the nucleoside phosphoramidite and a 5'-O-free nucleoside, in which equimolar amounts of the reactants and the promoter are employed in the presence of powdery molecular sieves 3A in acetonitrile. It has been shown that some azolium salts serve as excellent promoters in the solid-phase synthesis of oligodeoxyribonucleotides and oligoribonucleotides. For example, benzimidazolium triflate and N-(phenyl)imidazolium triflate can be used as effective promoters in the synthesis of an oligodeoxyribonucleotide, (5')CGACACCCAATTCTGAAAAT(3') (20mer), via a method using O-allyl/N-allyloxycarbonyl-protected deoxyribonucleoside 3'-phosphoramidites or O-(2-cyanoethyl)/N-phenoxyacetyl-protected deoxyribonucleotide 3'-phosphoramidite as building blocks, respectively, on high-cross-linked polystyrene resins. Further, N-(phenyl)imidazolium triflate is useful for the solid-phase synthesis of oligoribonucleotides, such as (5')AGCUACGUGACUACUACUUU(3') (20mer), according to an allyl/allyloxycarbonyl-protected strategy. The utility of the azolium promoter has been also demonstrated in the liquid-phase synthesis of some biologically important substances, such as cytidine-5'-monophosphono-N-acetylneuraminic acid (CMP-Neu5Ac) and adenylyl(2'-5')adenylyl(2'-5')adenosine (2-5A core).     

Study of Interaction between Red-tide Toxin, Domoic Acid and Double ——stranded DNA by Capillary Zone Electrophoresis

The interactions between amnesic red-tide toxin, domoic acid (DA) and 14mer double-stranded DNA (dsDNA with three kinds of sequences) were studied by capillary zone electrophoresis (CZE). For the dsDNA with a sequence of 5‘-CCCCCTATACCCGC-3‘, the amount of free dsDNA decreases with the increase of added DA, and the signal of DA-dsDNA complex was observed. Meanwhile, the other two dsDNAs, 5‘-(C)12GC-3‘ and 5‘-(AT)7-3‘, the existence of DA could not lead to the change of dsDNA signal and indicated that there is no interaction between DA and these two dsDNAs.     

Solution self-assembly, spontaneous deprotonation, and crystal structures of bipyrazolate-bridged metallomacrocycles with dimetal centers

A series of nanosized cavity-containing bipyrazolate-bridged metallomacrocycles with dimetal centers, namely, {[(bpy)M]8L4}(NO3)8 [L=3,3',5,5'-tetramethyl-4,4'-bipyrazolyl, Pd, Pt; 1,4-bis-4'-(3',5'-dimethyl)-pyrazolylbenzene), Pd; and 1,4-bis-4'-(3',5'-dimethyl)-pyrazolylbiphenyl, Pd], {[(phen)M]8L4}(NO3)8 [L=3,3',5,5'-tetramethyl-4,4'-bipyrazolyl, Pd, Pt; 1,4-bis-4'-(3',5'-dimethyl)-pyrazolylbenzene, Pd; and 1,4-bis-4'-(3',5'-dimethyl)-pyrazolylbiphenyl, Pd], {[(bpy)Pd]6L3}(NO3)6 [L=1,4-bis-4'-(3',5'-dimethyl)-pyrazolylbenzene,], {[(phen)Pd]6L3}(NO3)6 [L=1,4-bis-4'-(3',5'-dimethyl)-pyrazolylbenzene,], {[(bpy)Pd]4L2}(NO3)4 [L=1,3-bis-4'-(3',5'-dimethyl)-pyrazolylbenzene, and 1,2-bis-4'-(3',5'-dimethyl)-pyrazolylbenzene,], and {[(phen)Pd]4L2}(NO3)4 [L=1,3-bis-4'-(3',5'-dimethyl)-pyrazolylbenzene, and 1,2-bis-4'-(3',5'-dimethyl)-pyrazolylbenzene,] (where bpy=2,2'-bipyridine and phen=1,10-phenanthroline) have been synthesized through a directed self-assembly approach that involves spontaneous deprotonation of the 1H-bipyrazolyl ligands in aqueous solution. These complexes, with weak Pd(II)...Pd(II) or Pt(II)...Pt(II) interactions, have been characterized by elemental analysis, 1H and 13C NMR, cold-spray ionization or electrospray ionization mass spectrometry, UV-visible spectroscopy, and luminescence spectroscopy. Complexes and have also been characterized by single-crystal X-ray diffraction analysis.     

Rapid assay of cyclic AMP phosphodiesterase and 5'-nucleotidase by means of chromatography on cellulose-nitrate membrane strips

A simple chromatographic procedure with the use of modified cellulose-nitrate membrane strips, 80 x 40 mm, has been worked out for the rapid isotopic assay of cyclic AMP (cAMP) phosphodiesterase (EC 3.1.4.17) and 5'-AMP nucleotidase (EC 3.1.3.5) in crude extracts of various tissues from animals and plants. The assay is based on enzymatic conversion of the product to adenine, a relatively inert compound which, in contrast to cAMP and 5'-AMP, is strongly adsorbed by the cellulose-nitrate membrane. Due to this property rapid separation of adenine from the unconverted substrate (cAMP or 5'-AMP) is possible. Commercial 5'-nucleotidase and easily obtainable crude extract of adenosine nucleosidase from barley leaves are used as coupling enzymes for the phosphodiesterase assay. The assay of phosphodiesterase in 0.5-2 microliter of blood (10(-5) to 4.10(-5) units) has been demonstrated on several examples.     

Total synthesis of 2',3',4',5',5' '-(2)h(5)-ribonucleosides: the key building blocks for NMR structure elucidation of large RNA

The diastereospecific chemical syntheses of uridine-2',3',4',5',5' '-(2)H(5) (21a), adenosine-2',3',4',5',5' '-(2)H(5) (21b), cytidine-2',3',4',5',5' '-(2)H(5)(2)H(5) (21c), and guanosine-2',3',4',5',5' '-(2)H(5) (21d) (>97 atom % (2)H at C2', C3', C4', and C5'/C5' ') have been achieved for their use in the solution NMR structure determination of oligo-RNA by the Uppsala "NMR-window" concept (refs 4a-c, 5a, 6), in which a small (1)H segment is NMR-visible, while the rest is made NMR-invisible by incorporation of the deuterated blocks 21a-d. The deuterated ribonucleosides 21a-d have been prepared by the condensation of appropriately protected aglycone with 1-O-acetyl-2,3,5-tri-O-(4-toluoyl)-alpha/beta-D-ribofuranose-2,3,4,5,5'-(2)H(5) (19), which has been obtained via diastereospecific deuterium incorporation at the C2 center of appropriate D-ribose-(2)H(4) derivatives either through an oxidation-reduction-inversion sequence or a one-step deuterium-proton exchange in high overall yield (44% and 24%, respectively).