Synthesis of Some Novel 2,6- Dimethoxyhydroquinone-3- mercaptoacetyl-peptide Conjugates as Potential Antitumor Agents

2, 6 - D imethoxyhydroquinon e - 3 -mere aptoac et ic ac id (D M Q -MA) I -3 is a syntheti cderivative of 2, 6 - d imethoxyp -b enzoqu inone (D M Q )#, whi oh is a n atUral fermentedproduct of wheat germ and was found to have a wide spectrUm of cytotoxicity againstvarious tUmor cell lines under the synergistic activation of L-ascorbic acid as reported byG.A.Szents. Owing to the very low aqueous solubility of DMQ, which is an apparentdisadvantage for the development as a vaccine, we prep…     

Postpolymerization modification of reactive polymers derived from vinylcyclopropane. III. Polymer sequential functionalization using a combination of amines with alkoxyamines,hydrazides, isocyanates,or acyl halides

A new 1,1‐disubstituted‐2‐vinylcyclopropane monomer bearing a ketone and a pentafluorophenyl ester was synthesized and successfully polymerized to yield a polymer with two side chain moieties readily available for post‐polymerization modification. After a quantitative modification of the pentafluorophenyl moiety with amines, a subsequent second functionalization reaction was successfully performed on the ketone moiety leading to a double side‐chain functionalized polymer using two different routes. The first route utilized hydrazide and hydroxylamine derivatives leading to a ketone conversion of 25 to 85%. In the second route, the ketone moiety was first reduced to alcohol (reduction conversion up to 100%) and then converted into the corresponding ester or urethane using acyl halides or isocyanates, respectively, with a conversion ratio of up to 90%. A library of functionalized polymers was synthesized to confirm the effectiveness of this approach. © 2014 Wiley Periodicals, Inc. J. Polym. Sci., Part A: Polym. Chem. 2014 , 52, 2841–2849     

Synthesis of Maleimide‐Functionalyzed HPMA‐Copolymers and in vitro Characterization of the aRAGE‐ and Human Immunoglobulin (huIgG)–Polymer Conjugates

Herein the synthesis of antibody–polymer conjugates, with a quite narrow dispersity based on the polymer HPMA, are reported. These conjugates are synthesized by coupling antibodies to maleimide‐functionalized poly(N‐(2‐hydroxypropyl)‐methacrylamide) (poly‐HPMA) copolymers derived through reversible addition‐fragmentation chain transfer (RAFT) polymerization of pentafluorophenyl methacrylate via the intermediate step of an activated ester polymer. We develop a protocol that allows the attachment of two different model antibodies, monoclonal anti‐RAGE (receptor for advanced glycation end‐products) antibody, and polyclonal human immunoglobulin (huIgG). Modification of the antibody and conjugation is monitored by SDS‐PAGE electrophoresis. Preserved affinity is demonstrated by Western Blott and cell‐uptake analysis, for example, to cells of the immune system.

     

A simple and efficient synthesis of functionalized cyclic carbonate monomers using a versatile pentafluorophenyl ester intermediate

An improved two-step synthetic route to functionalized cyclic carbonate monomers that features a novel cyclic carbonate intermediate with an active pentafluorophenyl ester group (MTC-OPhF(5)) has been developed. The versatile pentafluorophenyl ester intermediate can be synthesized on the gram to kilogram scale in one high-yielding step and is easy to store and handle on the benchtop. The active pentafluorophenyl ester of MTC-OPhF(5) is amenable to further substitution with suitable nucleophiles such as alcohols and amines to generate functionalized cyclic carbonates in high yields. The substitution reaction is tolerant of a wide variety of functionalities, including various hydrophobic and hydrophilic groups, reactive functionalities (via thiol-ene click chemistry or alkyl halides), and protected acids, alcohols, thiols, and amines. In view of the ever-increasing need for biodegradable and biocompatible polymers, this new methodology provides a simple and versatile platform for the synthesis of new and innovative materials.     

Alcalase-catalyzed Synthesis of Novel 2,6-Dimethoxyhydroquinone-3-mercaptoacetyl-peptide Conjugates

Seven dipeptide and one tripeptide conjugates of the cytotoxic drug 2,6-dimethoxyhydroquinone-3-mercaptoacetic acid (DMQ-MA) conjugates were prepared successfully by an alcalase-catalyzed reaction in alcohols, using DMQ-MA-X-OMe as the acyl donor and H₂N-Y-CONH₂ as the nucleophile (where X and Y are amino acids, and amino acid/dipeptides, respectively).     

Solid-phase synthesis of positively charged deoxynucleic guanidine (DNG) tethering a Hoechst 33258 analogue: triplex and duplex stabilization by simultaneous minor groove binding

Deoxynucleic guanidine (DNG), a DNA analogue in which positively charged guanidine replaces the phosphodiester linkages, tethering to Hoechst 33258 fluorophore by varying lengths has been synthesized. A pentameric thymidine DNG was synthesized on solid phase in the 3' --> 5' direction that allowed stepwise incorporation of straight chain amino acid linkers and a bis-benzimidazole (Hoechst 33258) ligand at the 5'-terminus using PyBOP/HOBt chemistry. The stability of (DNA)(2).DNG-H triplexes and DNA.DNG-H duplexes formed by DNG and DNG-Hoechst 33258 (DNG-H) conjugates with 30-mer double-strand (ds) DNA, d(CGCCGCGCGCGCGAAAAACCCGGCGCGCGC)/d(GCGGCGCGCGCGCTTTTTGGGCCGCGCGCG), and single-strand (ss) DNA, 5'-CGCCGCGCGCGCGAAAAACCCGGCGCGCGC-3', respectively, has been evaluated by thermal melting and fluorescence emission experiments. The presence of tethered Hoechst ligand in the 5'-terminus of the DNG enhances the (DNA)(2).DNG-H triplex stability by a DeltaT(m) of 13 degrees C. The fluorescence emission studies of (DNA)(2).DNG-H triplex complexes show that the DNG moiety of the conjugates bind in the major groove while the Hoechst ligand resides in the A:T rich minor groove of dsDNA. A single G:C base pair mismatch in the target site decreases the (DNA)(2).DNG triplex stability by 11 degrees C, whereas (DNA)(2).DNG-H triplex stability was decreased by 23 degrees C. Inversion of A:T base pair into T:A base pair in the center of the binding site, which provides a mismatch selectively for DNG moiety, decreases the triplex stability by only 5-6 degrees C. Upon hybridization of DNG-Hoechst conjugates with the 30-mer ssDNA, the DNA.DNG-H duplex exhibited significant increase in the fluorescence emission due to the binding of the tethered Hoechst ligand in the generated DNA.DNG minor groove, and the duplex stability was enhanced by DeltaT(m) of 7 degrees C. The stability of (DNA)(2).DNG triplexes and DNA.DNG duplexes is independent of pH, whereas the stability of (DNA)(2).DNG-H triplexes decreases with increase in pH.     

Efficient synthesis of branched poly(acrylic acid) derivatives via postpolymerization modification

The utility of pentafluorophenyl esters for the selective introduction of functional units and branch points in well-defined poly(acrylic acid) (PAA) derivatives is demonstrated using a combination of controlled radical polymerization and postpolymerization modification. Reversible addition-fragmentation chain transfer enables the synthesis of well-defined copolymers—poly(pentafluorophenyl acrylate-co-tert-butyl acrylate)—with the active ester repeat units serving as attachment points for reaction with primary amines, specifically tris(2-(t-butoxycarbonyl)ethyl)methyl amine (Behera's amine). Deprotection using trifluoroacetic acid removes both the backbone and side chain t-butyl esters to give a series of branched PAA derivatives containing novel tricarboxylic acid side chains that are well suited to complexation and multidentate interactions. Surprisingly, the active ester homopolymer is shown to have the highest reactivity with Behera's amine when compared to copolymers with lower incorporation of pentafluorophenyl esters, suggesting an intriguing interplay of neighboring group effects and steric interactions. The ability to tune the efficiency of postpolymerization modification gives a library of PAA derivatives.     

1-Acetylpyrene with dual functions as an environment-sensitive fluorophore and fluorescent photoremovable protecting group

A series of new fluorescent ester conjugates of carboxylic acids including amino acids was synthesized by coupling with an environment-sensitive fluorophore 1-acetylpyrene. Interestingly, the fluorescence properties of the ester conjugates and 1-acetylpyrene were found to be highly sensitive to its surrounding environment. The results obtained from the photolysis of the ester conjugates indicated that various factors like solvent, irradiation wavelength, and the structure of the conjugates govern the rate of the photocleavage.     

Preparation of chiral amino acid materials and the study of their interactions with 1,1‐Bi‐2‐naphthol

The amino acid tryptophan has been converted into acrylamide monomers using L /D ‐tryptophan methyl ester forming the enantiopure chiral monomers. Attempts were made to polymerize these monomers via reversible addition fragmentation chain transfer (RAFT) polymerization to form poly(tryptophan). Unfortunately, this proved difficult, and instead, a postpolymerization modification route was used by first synthesizing poly(pentafluorophenyl acrylate) via RAFT, which was then substituted with L ‐tryptophan methyl ester to give poly(L ‐tryptophan). The interactions of the newly synthesized tryptophan monomers, as well as previously reported phenylalanine monomers, were studied in the presence of rac‐BINOL. It has been shown that the enantiomers of tryptophan have a stronger interaction with BINOL than phenylalanine and this has been attributed to the larger π system on the side chain. By monitoring the shifts and splitting of the phenolic protons of BINOL, it has been observed that S‐BINOL interacts more favorably with L ‐monomer enantiomers and R‐BINOL with D ‐monomer enantiomers. Similar interactions have also been seen with poly(phenylalanine) and the newly synthesized poly(tryptophan) materials. © 2012 Wiley Periodicals, Inc. J Polym Sci Part A: Polym Chem, 2012     

Sequential conversion of orthogonally functionalized diblock copolymers based on pentafluorophenyl esters

Statistic and block copolymers exhibiting activated ester side groups were synthesized by reversible addition‐fragmentation chain transfer polymerization in the presence of cumyl dithiobenzoate, benzyl dithiobenzoate, and 4‐cyano‐4‐((thiobenzoyl)sulfanyl)pentanoic acid as chain transfer agents. Pentafluorophenyl methacrylate and pentafluorophenyl 4‐vinylbenzoate were used to enable a sequential functionalization of the obtained copolymers by conversion of the activated esters with different amines. ¹H NMR spectroscopy, ¹⁹F NMR spectroscopy, and FTIR spectroscopy showed the successful step‐by‐step conversion of the different activated esters by aniline followed by aliphatic amines, thereby realizing a sequential functionalization of block copolymers with just one specific reactive group. © 2010 Wiley Periodicals, Inc. J Polym Sci Part A: Polym Chem 48: 3683–3692, 2010     

Synthesis of polymeric 1‐iminopyridinium ylides as photoreactive polymers

Two synthetic routes to polymeric 1‐imino pyridinium ylides as new photoreactive polymeric architectures were investigated. In the first approach, polymerization of newly synthesized 1‐imino pyridinium ylide containing monomers yielding their polymeric analogues was achieved by free radical polymerization. Alternatively, reactive precursor polymers were synthesized and converted into the respective 1‐imino pyridinium ylide polymers by polymer analogous reactions on reactive precursor polymers. Quantitative conversion of the reactive groups was achieved with pentafluorophenyl ester containing polymers and newly synthesized photoreactive amines as well as by the reaction of poly(4‐vinylbenzoyl azide) with a photoreactive alcohol. The polymers obtained by both routes were examined regarding their photoreaction products and kinetics in solution as well as in thin polymer films. Contact angle measurements of water on the polymer films before and after irradiation showed dramatic changes in the hydrophilicity of the polymers. © 2010 Wiley Periodicals, Inc. J Polym Sci Part A: Polym Chem 48: 832–844, 2010     

RAFT polymerization of activated 4‐vinylbenzoates

The reversible addition fragmentation chain transfer (RAFT) polymerization of five active ester monomers based on 4‐vinylbenzoic acid had been investigated. Pentafluorophenyl 4‐vinylbenzoate could be polymerized under RAFT conditions yielding polymers with very good control over molecular weight and narrow molecular weight distributions. Following the synthesis of diblock copolymers consisting of polystyrene, polypentafluorostyrene, poly(4‐octylstyrene), or poly(4‐acetoxystyrene) as an inert block and poly(pentafluorophenyl 4‐vinylbenzoate) as a reactive block was successfully performed. The diblock copolymer poly(pentafluoro styrene)‐block‐poly(pentafluorophenyl 4‐vinylbenzoate) had been analyzed by ¹⁹F NMR spectroscopy in solution, demonstrating the synthetic potential of pentafluorophenyl 4‐vinylbenzoate as an extremely valuable monomer for the synthesis of highly functionalized polymeric architectures. © 2009 Wiley Periodicals, Inc. J Polym Sci Part A: Polym Chem 47: 1696–1705, 2009     

Four-way-branched DNA-porphyrin conjugates for construction of four double-helix-DNA assembled structures

[reaction: see text] DNA-porphyrin conjugates having four DNA strands were designed and synthesized. Four double helices were assembled using two DNA-porphyrin conjugates and their complementary strands, and the formation of the four double-helix assembled structures with the two DNA-porphyrin units was examined by gel electrophoresis and spectroscopic analysis. The interaction between two porphyrin chromophores in the complex was investigated by measurement of fluorescence lifetimes, and the singlet energy transfer between the two different phorphyrin units (Zn-porphyrin and H2-porphyrin) was observed. These results indicate that multiple and different porphyrin chromophores can be integrated into the DNA structures by programming the sequences of the DNA strands.     

Preparation of biodegradable and thermoresponsive enzyme–polymer conjugates with controllable bioactivity via RAFT polymerization

The preparation of biodegradable and thermoresponsive enzyme–polymer bioconjugates with controllable enzymatic activity via reversible addition−fragmentation chain transfer (RAFT) polymerization and amidation conjugation reaction is presented. A new 2-mercaptothiazoline ester functionalized RAFT agent with intra-disulfide linkage was synthesized and used as chain transfer agent (CTA) to generate a biocompatible homopolymer, poly(ethyleneglycol) acrylate (polyPEG-A) and a thermoresponsive copolymer of poly(ethyleneglycol) acrylate with di(ethyleneglycol)ethyl ether acrylate [poly(PEG-A-co-DEG-A)]. These biodegradable and thermoresponsive polymers were then conjugated to the surface of glucose oxidase (GOx) under mild condition to afford the biodegradable and thermoresponsive enzyme–polymer conjugates. Cleavage of the polymer chains from the GOx surface obviously recovered the enzymatic activity. The thermoresponsive test of GOx-poly(PEG-A-co-DEG-A) revealed that the bioconjugate exhibited regular enzymatic activity fluctuation upon the temperature change below or above the lower critical solution temperature (LCST). The as-prepared enzyme–polymer conjugates were also characterized using ¹H NMR, UV–vis spectroscopy, polyacrylamide gel electrophoresis (PAGE) and biocatalytic activity tests. These smart enzyme–polymer conjugates would envision promising applications in biotechnology and biomedicine.     

Novel designed polymer–acyclovir conjugates with linker‐controlled drug release and hepatoma cell targeting

To develop designed polymer–drug conjugates, where the rate of drug liberation and hepatoma cell targeting function could be rationally and widely controlled, we facilely synthesized a series of novel, galactose‐functionalized polymer–acyclovir conjugates with different linkers and first reported the effect of the linker structure including the type of acyclovir‐linked bond (an ester bond or an amide bond) and relative length of the linker between acyclovir and the polymer main chain on release rate and targeting ability of conjugates. In vitro release studies showed that the cumulative released acyclovir from these polymer–acyclovir conjugates was between 24 and 65% in pH 1.2 glycine solution after 7 days. The ester bond more easily underwent hydrolysis than the amide bond. The longer the relative linker length was, the faster the acyclovir was released. The cell recognition experiments visualized using confocal laser scanning microscopy exhibited that the resultant galactose‐functionalized polymer–acyclovir conjugates had evident targeting to hepG2 cells, and targeting ability was also in connection with the relative length of linker. By choosing appropriate linker, cellular internalization of acyclovir could be well achieved. We consider these results to be helpful for the design of multifunctional polymeric prodrugs, in which the required release rate and targeting ability could be rationally controlled by predetermined molecular architecture. © 2007 Wiley Periodicals, Inc. J Polym Sci Part A: Polym Chem 46: 117–126, 2008     

Synthesis and postfunctionalization of well‐defined star polymers via “double” click chemistry

In this article, the synthesis and the functionalization of well‐defined, narrow polydispersity (polydispersity index < 1.2) star polymers via reversible addition‐fragmentation chain transfer polymerization is detailed. In this arm first approach, the initial synthesis of a poly(pentafluorophenyl acrylate) polymer, and subsequent, cross‐linking using bis‐acrylamide to prepare star polymers, has been achieved by reversible addition fragmentation chain transfer polymerization. These star polymers were functionalized using a variety of amino functional groups via nucleophilic substitution of pentafluorophenyl activated ester to yield star polymers with predesigned chemical functionality. This approach has allowed the synthesis of star glycopolymer using a very simple approach. Finally, the core of the stars was modified via thiol‐ene click chemistry reaction using fluorescein‐o‐acrylate and DyLigh 633 Maleimide. © 2011 Wiley Periodicals, Inc. J Polym Sci Part A: Polym Chem, 2011     

Synthesis of porphyrin-quinolone conjugates

meso-Tetrakis(pentafluorophenyl)porphyrin reacts with propargyl alcohol to afford porphyrins substituted with one, two, three or four prop-2-yn-1-yloxy groups in the 4-position of the meso-aryl groups. These new porphyrin derivatives react with a 6-azidoquinolone under ‘click-chemistry’ conditions to give porphyrin-quinolone conjugates linked by 1,2,3-triazole units.     

New ferrocene-containing structures: Poly(silyl ester)s

Two new polymeric structures containing ferrocene units along the chains, namely poly(silyl ester)s, have been synthesized and characterized: a geminal poly(silyl ester) (g-PSE) and one having a disiloxane spacer between the silyl ester groups (s-PSE). The condensation polymerization of AA/BB monomer systems in solution was used in both cases as preparation method involving a silicon-containing diol, (diphenylsilane diol or 1,3-bis(hydroxy)-tetramethyldisiloxane), and 1,1′-di(chlorocarbonyl)ferrocene. The polymers were investigated by differential pulse voltammetry in order to evaluate the redox behavior. Due to the presence of the silyl ester groups in the chain, these polymers are hydrolytically degradable.     

Evaluation of the DNA Alkylation Properties of a Chlorambucil-Conjugated Cyclic Pyrrole-Imidazole Polyamide

Hairpin pyrrole-imidazole polyamides (hPIPs) and their chlorambucil (Chb) conjugates (hPIP-Chbs) can alkylate DNA in a sequence-specific manner, and have been studied as anticancer drugs. Here, we conjugated Chb to a cyclic PIP (cPIP), which is known to have a higher binding affinity than the corresponding hPIP, and investigated the DNA alkylation properties of the resulting cPIP-Chb using the optimized capillary electrophoresis method and conventional HPLC product analysis. cPIP-Chb conjugate 3 showed higher alkylation activity at its binding sites than did hPIP-Chb conjugates 1 and 2 . Subsequent HPLC analysis revealed that the alkylation site of conjugate 3 , which was identified by capillary electrophoresis, was reliable and that conjugate 3 alkylates the N3 position of adenine as do hPIP-Chbs. Moreover, conjugate 3 showed higher cytotoxicity against LNCaP prostate cancer cells than did conjugate 1 and cytotoxicity comparable to that of conjugate 2 . These results suggest that cPIP-Chbs could be novel DNA alkylating anticancer drugs.