A study of dark interaction and photoreaction between 4,6-dimethyltetrahydrobenzoangelicin (THBA) and DNA is described. 4,6-Dimethyltetrahydrobenzoangelicin is a furocoumarin derivative in which 4'and 5'carbons are linked by a four-methylene bridge. In spite of the bulky aliphatic ring, THBA forms a complex with DNA in the dark and, on UVA irradiation, reacts with pyrimidine bases of DNA yielding monoadducts only involving its furan side double bond. Two main photoproducts form: they derive from a C4-cycloaddition to thymine and cytosine, respectively, and account for 56% and 39% of the total photoreaction yield. Both show cis-syn configuration. Two other isomers, one with thymine and one with cytosine, formed with so much lower yield ( ca 3 and 1%, respectively) that their structure could not be assigned. Furthermore, in spite of its angular structure, THBA induces a small number of crosslinks in DNA. 相似文献
Catalysis of the beta-elimination reaction of N-[2-(4-pyridyl)ethyl]quinuclidinium (1) and N-[2-(2-pyridyl)ethyl]quinuclidinium (2) by Zn(2+) and Cd(2+) in OH(-)/H(2)O (pH = 5.20-6.35, 50 degrees C, and mu = 1 M KCl) has been studied. In the presence of Zn(2+), the elimination reactions of both isomers occur from the Zn(2+)-complexed substrates (C). The equilibrium constants for the dissociation of the Zn(2+)-complexes are as follows: K(d) = 0.012 +/- 0.003 M (isomer 1) and K(d) = 0.065 +/- 0.020 M (isomer 2). The value of k(C)(H2O) for isomer 1 is 4.81 x 10(-6) s(-1). For isomer 2 both the rate constants for the "water" and OH(-)-induced reaction of the Zn(2+)-complexed substrate could be measured, despite the low concentration of OH(-) in the investigated reaction mixture [k(C)H2O)= 1.97 x 10(-6) s(-1) and k(C)(OH-)= 21.9 M(-1) s(-1), respectively]. The measured metal activating factor (MetAF), i.e., the reactivity ratio between the complexed and the uncomplexed substrate, is 8.1 x 10(4) for the OH(-)-induced elimination of 2. This high MetAF can be compared with the corresponding proton activating factor (Alunni, S.; Conti, A.; Palmizio Errico, R. J. Chem. Soc., Perkin Trans. 2 2000, 453), PAF = 1.5 x 10(6) and is in agreement with an E1cb irreversible mechanism (A(xh)D(E)* + D(N)) (Guthrie, R. D.; Jencks, W. P. Acc. Chem. Res. 1989, 22, 343). A value of k(C)(H2O)>or= 23 x 10(-7) s(-1) is estimated for the Cd(2+)-complexed isomer 2, while catalysis by Cd(2+) has not been observed for isomer 1. 相似文献
The density of the 2-chloroethanol (CE) + 2-methoxyethanol (ME) + 1,2-dimethoxye- thane (DME) ternary mixtures has been measured at different temperatures ranging from –10 to 80°C, and over the entire composition range. The experimental data have been used to check the validity of some relationships accounting for the dependence of the density on temperature and composition domains. Starting from the primary data, some derived quantities, such as excess molar volumes VE, partial molar volumes
and partial excess molar volumes
, have been obtained. In these mixtures, VE is always positive for the [CE(1) + ME(2)] binaries, while it is generally negative at all other experimental conditions, showing the greatest deviations along the binary axes corresponding to the binary subsystems in the sequence [CE(1) + DME(2)] < [CE(1) + ME(2)] < [ME(1) + DME(2)]. The results are compared and discussed to in terms of changes in molecular association and structural effects in these solvent systems. 相似文献
Kinematic viscosities were measured for 2-butanone + 2-butanol binary liquid mixtures with a capillary Ubbelohde routine viscometer in the temperature range from 273.15 to 353.15 K at atmospheric pressure, and covering the whole miscibility field (0xi1). Experimental data have been correlated by means of different empirical or semiempirical relationships, such as =(T), =(xi), and =(T, xi). Viscosity deviations, , from ideal behavior are negative at all experimental conditions, confirming that structure breaking effects prevail in the liquids. Furthermore, the thermodynamics of viscous flow and excess Gibbs energy of activation of viscous flow, G*E, have been calculated. As an alternative and complementary approach to such investigations, the fluidity () of this binary system has been analyzed by the modified—Batschinski theory. The results are discussed in terms of the specific molecular interactions between the mixture components. 相似文献
Trans-polydatin (tPD), the 3-β-D-glucoside of the well-known nutraceutical trans-resveratrol, is a natural polyphenol with documented anti-cancer, anti-inflammatory, cardioprotective, and immunoregulatory effects. Considering the anticancer activity of tPD, in this work, we aimed to explore the binding properties of this natural compound with the G-quadruplex (G4) structure formed by the Pu22 [d(TGAGGGTGGGTAGGGTGGGTAA)] DNA sequence by exploiting CD spectroscopy and molecular docking simulations. Pu22 is a mutated and shorter analog of the G4-forming sequence known as Pu27 located in the promoter of the c-myc oncogene, whose overexpression triggers the metabolic changes responsible for cancer cells transformation. The binding of tPD with the parallel Pu22 G4 was confirmed by CD spectroscopy, which showed significant changes in the CD spectrum of the DNA and a slight thermal stabilization of the G4 structure. To gain a deeper insight into the structural features of the tPD-Pu22 complex, we performed an in silico molecular docking study, which indicated that the interaction of tPD with Pu22 G4 may involve partial end-stacking to the terminal G-quartet and H-bonding interactions between the sugar moiety of the ligand and deoxynucleotides not included in the G-tetrads. Finally, we compared the experimental CD profiles of Pu22 G4 with the corresponding theoretical output obtained using DichroCalc, a web-based server normally used for the prediction of proteins’ CD spectra starting from their “.pdb” file. The results indicated a good agreement between the predicted and the experimental CD spectra in terms of the spectral bands’ profile even if with a slight bathochromic shift in the positive band, suggesting the utility of this predictive tool for G4 DNA CD investigations. 相似文献
The zinc deposition reaction onto metallic zinc has been investigated at the single particle level through the electrode-particle collision method in neutral solutions, and in respect of its dependence on the applied potential and the ionic strength of a sulphate-containing solution. Depending on the concentration of sulphate ions in solution, different amounts of metallic zinc were deposited on the single Zn nanoparticles. Specifically, insights into the electron transfer kinetics at the single particles were obtained, indicating an electrically early reactant-like transition state, which is consistent with the rate-determining partial de-hydration/de-complexation process. Such information on the reaction kinetics at the nanoscale is of vital importance for the development of more efficient and long-lasting nanostructured Zn-based negative electrodes for Zn-ion battery applications.
AbstractSpices and aromatic herbs can be contaminated with mycotoxins, since of their preharvest, postharvest, and storage conditions. In this study, 112 samples of different spices and aromatic herbs were evaluated for their mycotoxins content by HPLC-MS/MS in order to highlight their possible risk linked with human use. The results showed that mycotoxins were occasionally detected only in samples of coriander, laurel, mint, rosemary, and verbena. In both geographical origins a different contamination was detected. Among the investigated mycotoxins, AFB2, AFG1, AFG2, T2 and HT2 were detected, whereas none of the samples contained AFB1 and FB1. The co-occurrence of two toxins were observed for some samples of rosemary and verbena. This study indicates that it is essential minimize the toxins in agriculture, industry, and food-product manufacturing for the consumer health protection. 相似文献
Headspace solid‐phase microextraction is a solvent‐free sample preparation technique that is based on the equilibrium among a three‐phase system, i.e., sample‐headspace‐fiber. A compromise between sensitivity and extraction time is usually needed to optimize the sample throughput, especially when a large number of samples are analyzed, as usually the case in cross‐samples studies. This work explores the capability of multiple‐cumulative trapping solid‐phase microextraction on the characterization of the aroma profiling of olive oils, exploiting the automation capability of a novel headspace autosampler. It was shown that multiple‐cumulative solid‐phase microextraction has the potential to improve the overall sensitivity and burst the level of information for cross‐sample studies by using cumulative shorter extraction times. 相似文献