Current air quality analytics and monitoring: A review

This review summarizes the different tools and concepts that are commonly applied in air quality monitoring. The monitoring of atmosphere is extremely important as the air quality is an important problem for large communities. Main requirements for analytical devices used for monitoring include a long period of autonomic operation and portability. These instruments, however, are often characterized by poor analytical performance. Monitoring networks are the most common tools used for monitoring, so large-scale monitoring programmes are summarized here. Biomonitoring, as a cheap and convenient alternative to traditional sample collection, is becoming more and more popular, although its main drawback is the lack of standard procedures. Telemonitoring is another approach to air monitoring, which offers some interesting opportunities, such as ease of coverage of large or remote areas, constituting a complementary approach to traditional strategies; however, it requires huge costs.     

Epidemiological models with quadratic equation for endemic equilibria—A bifurcation atlas

The existence and occurrence, especially by a backward bifurcation, of endemic equilibria is of utmost importance in determining the spread and persistence of a disease. In many epidemiological models, the equation for the endemic equilibria is quadratic, with the coefficients determined by the parameters of the model. Despite its apparent simplicity, such an equation can describe an amazing number of dynamical behaviors. In this paper, we shall provide a comprehensive survey of possible bifurcation patterns, deriving explicit conditions on the equation's parameters for the occurrence of each of them, and discuss illustrative examples.     

Influence of organic modifiers on morphology and crystallization of poly(ϵ‐caprolactone)/synthetic clay intercalated nanocomposites

ε‐caprolactone was polymerized in the presence of neat montmorillonite or organomontmorillonites to obtain a variety of poly(ε‐caprolactone) (PCL)‐based systems loaded with 10 wt % of the silicates. The materials were thoroughly investigated by different X‐ray scattering techniques to determine factors affecting structure of the systems. For one of the nanocomposites it was found that varying the temperature in the range corresponding to crystallization of PCL causes reversible changes in the interlayer distance of the organoclay. Extensive experimental and literature studies on this phenomenon provided clues indicating that this effect might be a result of two‐dimensional ordering of PCL chains inside the galleries of the silicate. Small angle X‐ray scattering and wide angle X‐ray scattering investigation of filaments oriented above melting point of PCL revealed that polymer lamellae were oriented perpendicularly to particles of unmodified silicate, while in PCL/organoclay systems they were found parallel to clay tactoids. Calorimetric and microscopic studies shown that clay particles are effective nucleating agents. In the nanocomposites, PCL crystallized 20‐fold faster than in the neat polymer. The crystallization rate in nanocomposites was also significantly higher than in microcomposite. Further research provided an insight how the presence of the filler affects crystalline fraction and spherulitic structure of the polymer matrix in the investigated systems. © 2007 Wiley Periodicals, Inc. J Polym Sci Part B: Polym Phys 45: 2350–2367, 2007     

Paraxial designing of planar waveguide variable-index focusing elements: Part 2—lenses of elliptical symmetry

A paraxial ray-optics formalism proposed for designing radially symmetric variable-index lenses is extended to the case of lenses of elliptical symmetry of the index profile.     

The localization of energy in gauge field theories and in linear gravitation

It is shown how the energy-positivity criterion enables us to localize the energy in various field theories. For this purpose the role of surface integrals in a canonical formalism is investigated. The same techniques are applied to linearized gravity, where the mixed Cauchy-boundary value problem in a finite volume is analyzed. Unconstrained degrees of freedom and boundary data which have to be controlled are found. This paper is part of a program to analyze the possibility of localization of gravitational energy in complete General Relativity.     

Global existence inL 1 for the modified nonlinear Enskog equation in ℝ3

A global existence theorem with large initial data inL ¹ is given for the modified Enskog equation in ³. The method, which is based on the existence of a Liapunov functional (analog of theH-Boltzmann theorem), utilizes a weak compactness argument inL ¹ in a similar way to the DiPerna-Lions proof for the Boltzmann equation. The existence theorem is obtained under certain condition on the behavior of the geometric factorY. The condition onY amounts to the fact that theL ¹ norm of the collision term grows linearly when the local density tends to infinity.     

A model of adsorption at liquid-solid interface involving association in the bulk phase

A model of monolayer adsorption of binary liquid mixtures on homogeneous and heterogeneous solid surfaces involving association of one component in the bulk phase is discussed. Suitable model calculations, illustrating association and heterogeneity effects, have been performed according to an equation derived for adsorption excess. This equation has been examined by using the experimental data of adsorption of alcohols from benzene andn-heptane on silica gel.

---

Adsorptionsmodell für die Grenzfläche Feststoff-Flüssigkeit unter Berücksichtigung der Assoziation in der Flüssigkeitsphase

Zusammenfassung Es wird ein Adsorptionsmodell binärer, flüssiger Mischungen an homogenen und heterogenen Oberflächen von Feststoffen unter Beachtung der Assoziation eines der Bestandteile in der Flüssigkeitsphase diskutiert. Mit der aus dem Oberflächenüberschuß abgeleiteten Gleichung wurden entsprechende Modellberechnungen durchgeführt, die die mit Assoziation und Heterogenität verbundenen Effekte illustrieren. Die Gleichung wurde für die experimentellen Daten der Alkoholadsorption aus Benzol undn-Heptan an Kieselgel überprüft.

     

Intra- and intermolecular fluorescence quenching in 7-(pyridyl)indoles

Three isomeric 7-(pyridyl)indoles reveal very different, solvent-dependent photophysical properties. Due to rapid excited state depopulation involving intramolecular hydrogen bonding, 7-(2′-pyridyl)indole is practically nonfluorescent at room temperature. In nonpolar and polar aprotic solvents, 7-(3′-pyridyl)indole and 7-(4′-pyridyl)indole fluorescence strongly, but the emission is quenched in alcohols. Syn and anti rotameric forms of 7-(3′-pyridyl)indole are detected, each quenched to a different degree. This differential quenching is interpreted as evidence of enhanced S₁ → S₀ internal conversion being more efficient in cyclic solvates, with alcohol molecules forming a bridge between the proton donor and acceptor groups of an excited chromophore.     

2,2,5,5-tetramethylpyrrolidin-3-one-1-sulfinyl group for 5'-hydroxyl protection of deoxyribonucleoside phosphoramidites in the solid-phase preparation of DNA oligonucleotides

Several nitrogen-sulfur reagents have been investigated as potential 5'-hydroxyl protecting groups for deoxyribonucleoside phosphoramidites to improve the synthesis of oligonucleotides on glass microarrays. Out of the nitrogen-sulfur-based protecting groups so far investigated, the 2,2,5,5-tetramethylpyrrolidin-3-one-1-sulfinyl group exhibited near optimal properties for 5'-hydroxyl protection by virtue of the mildness of its deprotection conditions. Specifically, the iterative cleavage of a terminal 5'-sulfamidite group in the synthesis of 5'-d(ATCCGTAGCCAAGGTCATGT) on controlled-pore glass is efficiently accomplished by treatment with iodine in the presence of an acidic salt. Hydrolysis of the oligonucleotide to its 2'-deoxyribonucleosides upon exposure to snake venom phosphodiesterase and bacterial alkaline phosphatase did not reveal the formation of any nucleobase adducts or other modifications. These findings indicate that the 2,2,5,5-tetramethylpyrrolidin-3-one-1-sulfinyl group for 5'-hydroxyl protection of phosphoramidites, such as 10a-d, may lead to the production of oligonucleotide microarrays exhibiting enhanced specificity and sensitivity in the detection of nucleic acid targets.