Guanidine‐Based Polymer Brushes Grafted onto Silica Nanoparticles as Efficient Artificial Phosphodiesterases

Polymer brushes grafted to the surface of silica nanoparticles were fabricated by atom‐transfer radical polymerization (ATRP) and investigated as catalysts in the cleavage of phosphodiesters. The surfaces of silica nanoparticles were functionalized with an ATRP initiator. Surface‐initiated ATRP reactions, in varying proportions, of a methacrylate moiety functionalized with a phenylguanidine moiety and an inert hydrophilic methacrylate species afforded hybrid nanoparticles that were characterized with potentiometric titrations, thermogravimetric analysis, and SEM. The activity of the hybrid nanoparticles was tested in the transesterification of the RNA model compound 2‐hydroxypropyl para‐nitrophenylphosphate (HPNP) and diribonucleoside monophosphates. A high catalytic efficiency and a remarkable effective molarity, thus overcoming the effective molarities previously observed for comparable systems, indicate the existence of an effective cooperation of the guanidine/guanidinium units and a high level of preorganization in the nanostructure. The investigated system also exhibits a marked and unprecedented selectivity for the diribonucleoside sequence CpA. The results presented open up the way for a novel and straightforward strategy for the preparation of supramolecular catalysts.     

Dynamics of kinks in biological membranes

kinks created in a biological membrane by the interaction with a movable bead. We arrive at the evolution equations for both the bead and the membrane, whence we conclude that the force exerted on the bead by a fixed membrane points in the direction along which the curvature of the membrane is more concentrated. This is the first step towards understanding the basic mechanism behind the dynamics of protein aggregation which takes place on biological membranes. Received November 6, 2001 / Published online February 4, 2002     

Some remarks on the identity between a variational integral and its relaxed functional

Summary Letf: (x, z)∈R ⁿ×Rⁿ→f(x, z)∈[0, +∞] be measurable inx and convex inz. It is proved, by an example, that even iff verifies a condition as|z| ^p≤f(x, z)≤Λ(a(x)+|z|^q) with 1<p<q,a∈L _loc ^s (R ⁿ),s>1, the functional that isL ¹(Ω)-lower semicontinuous onW ^1,1(Ω), does not agree onW ^1,1(Ω) with its relaxed functional in the topologyL ¹(Ω) given by inf

---

Riassunto Siaf: (x, z)∈R ⁿ×Rⁿ→f(x, z)∈[0, +∞] misurabile inx e convessa inz. Si mostra con un esempio che anche sef verifica una condizione del tipo|z| ^p≤f(x, z)≤Λ(a(x)+|z|^q) con 1<p<q,a∈L _loc ^s (R ⁿ),s>1, il funzionale , che èL ¹(Ω)-semicontinuo inferiormente suW ^1,1(Ω), non coincide suW ^1,1(Ω) con il suo funzionale rilassato nella topologiaL ¹(Ω) definito da inf

     

The projection approach to the Fokker-Planck equation. I. Colored Gaussian noise

It is shown that the Fokker-Planck operator can be derived via a projection-perturbation approach, using the repartition of a more detailed operator into a perturbation ₁ and an unperturbed part ₀. The standard Fokker-Planck structure is recovered at the second order in ₁, whereas the perturbation terms of higher order are shown to provoke the breakdown of this structure. To get rid of these higher order terms, a key approximation, local linearization (LL), is made. In general, to evaluate at the second order in ₁ the exact expression of the diffusion coefficient which simulates the influence of a Gaussian noise with a finite correlation time, a resummation up to infinite order in must be carried out, leading to what other authors call the best Fokker-Planck approximation (BFPA). It is shown that, due to the role of terms of higher order in ₁, the BFPA leads to predictions on the equilibrium distributions that are reliable only up to the first order in t. The LL, on the contrary, in addition to making the influence of terms of higher order in ₁ vanish, results in a simple analytical expression for the term of second order that is formally coincident with the complete resummation over all the orders in t provided by the Fox theory. The corresponding diffusion coefficient in turn is shown to lead in the limiting case to exact results for the steady-state distributions. Therefore, over the whole range 0 the LL turns out to be an approximation much more accurate than the global linearization proposed by other authors for the same purpose of making the terms of higher order in ₁ vanish. In the short- region the LL leads to results virtually coincident with those of the BFPA. In the large- region the LL is a more accurate approximation than the BFPA itself. These theoretical arguments are supported by the results of both analog and digital simulation.     

New pi-extended water-soluble squaraines as singlet oxygen generators

[graph: see text] Condensation of squaric acid with a number of differently substituted 2-pyrrolyl derivatives afforded three new classes of squaraines. Their sharp and intense absorption bands in the biological window (700-900 nm), inherent singlet oxygen generation capabilities, together with proper functionalization allowing good water solubility make them suitable candidates as new non-porphyrinic singlet oxygen photosensitizers for photodynamic therapy (PDT).     

2,2,5,5-tetramethylpyrrolidin-3-one-1-sulfinyl group for 5'-hydroxyl protection of deoxyribonucleoside phosphoramidites in the solid-phase preparation of DNA oligonucleotides

Several nitrogen-sulfur reagents have been investigated as potential 5'-hydroxyl protecting groups for deoxyribonucleoside phosphoramidites to improve the synthesis of oligonucleotides on glass microarrays. Out of the nitrogen-sulfur-based protecting groups so far investigated, the 2,2,5,5-tetramethylpyrrolidin-3-one-1-sulfinyl group exhibited near optimal properties for 5'-hydroxyl protection by virtue of the mildness of its deprotection conditions. Specifically, the iterative cleavage of a terminal 5'-sulfamidite group in the synthesis of 5'-d(ATCCGTAGCCAAGGTCATGT) on controlled-pore glass is efficiently accomplished by treatment with iodine in the presence of an acidic salt. Hydrolysis of the oligonucleotide to its 2'-deoxyribonucleosides upon exposure to snake venom phosphodiesterase and bacterial alkaline phosphatase did not reveal the formation of any nucleobase adducts or other modifications. These findings indicate that the 2,2,5,5-tetramethylpyrrolidin-3-one-1-sulfinyl group for 5'-hydroxyl protection of phosphoramidites, such as 10a-d, may lead to the production of oligonucleotide microarrays exhibiting enhanced specificity and sensitivity in the detection of nucleic acid targets.