Wait-and-switch stochastic model of the non-Debye relaxation. Derivation of the Burr survival probability

Stochastic mechanism of relaxation, in which a dipole waits until a favourable condition for reorientation exists, is discussed. Assuming that an imposed direction of a dipole moment may be changed when a migrating defect reaches the dipole, we present a mathematically rigorous scheme relating the local random characteristics of a macroscopic system to its effective relaxation behaviour. We derive a relaxation function (the Burr survival probability) that is characterized by the stretched exponential or the power-law behaviour.     

2,2,5,5-tetramethylpyrrolidin-3-one-1-sulfinyl group for 5'-hydroxyl protection of deoxyribonucleoside phosphoramidites in the solid-phase preparation of DNA oligonucleotides

Several nitrogen-sulfur reagents have been investigated as potential 5'-hydroxyl protecting groups for deoxyribonucleoside phosphoramidites to improve the synthesis of oligonucleotides on glass microarrays. Out of the nitrogen-sulfur-based protecting groups so far investigated, the 2,2,5,5-tetramethylpyrrolidin-3-one-1-sulfinyl group exhibited near optimal properties for 5'-hydroxyl protection by virtue of the mildness of its deprotection conditions. Specifically, the iterative cleavage of a terminal 5'-sulfamidite group in the synthesis of 5'-d(ATCCGTAGCCAAGGTCATGT) on controlled-pore glass is efficiently accomplished by treatment with iodine in the presence of an acidic salt. Hydrolysis of the oligonucleotide to its 2'-deoxyribonucleosides upon exposure to snake venom phosphodiesterase and bacterial alkaline phosphatase did not reveal the formation of any nucleobase adducts or other modifications. These findings indicate that the 2,2,5,5-tetramethylpyrrolidin-3-one-1-sulfinyl group for 5'-hydroxyl protection of phosphoramidites, such as 10a-d, may lead to the production of oligonucleotide microarrays exhibiting enhanced specificity and sensitivity in the detection of nucleic acid targets.     

Binary and ternary chromium(III) complexes with cellular reductants and DNA components isolated from redox type systems. Part 1. Chromium(VI)–cysteine–adenine (adenosine,ATP)

The reduction of CrO₃ with an excess of L-cysteine and its interaction with DNA fragments (adenine, adenosine) and ATP nucleotide was studied by analysis of the isolated solid products. The precipitates were characterised by elemental analyses, FAB mass spectral data, spectroscopic methods (u.v.–vis., f.i.r., i.r.) and magnetic measurements. The Cr^III complexes obtained appear to be various Cr^III cysteinate and adenine or ATP (but not adenosine) ternary species of the addition type bound through the hydrogen bonding network.     

Carrier influence on the paramagnetic and catalytic properties of supported titanium complexes

Alumina-silica possessing various Al₂O₃/SiO₂ ratios was used as a carrier of surface titanium complexes. The systems obtained were examined as models for the investigation of the macroligand (inorganic gel) influence on the physicochemical properties of supported transition metal complexes. The titanium complexes were prepared first by the reaction of CpTiCl₃, with the hydroxyl groups of the gel and then reduced by an excess of BuLi. The influence was established of the basic gel properties on: (a) the amount of titanium(IV) and titanium(III) complexes on the alumina-silica gel surfaces; (b) the symmetry of the surface Ti^III surface complexes; (c) the electron density around the surface-Ti^III ions, ionic or covalent bonds character in a complex; and (d) the catalytic activity in olefin hydrogenation.     

Cis-coordination of the chromate anions in helical Co/Ni block-type polymeric systems. Structural and spectroscopic characteristics of catena(μ-CrO4-O,O′)[Co(HIm)3H2O] and catena(μ-CrO4-O,O′)[Co0.43Ni0.57(HIm)3H2O]

Two polymeric complexes: catena(μ-CrO₄-O,O′)[Co(HIm)₃H₂O] (1) and catena(μ-CrO₄-O,O′)[Co_0.43Ni_0.57(HIm)₃H₂O] (2) (where HIm=imidazole) with a cis-bridging coordination mode of the CrO₄ ²⁻ anion have been synthesized and characterized by X-ray and spectroscopic methods. These crystals were isolated from nine systems of varying reagent molar ratios and three excluding anions: Cl⁻, NO₃ ⁻ and SO₄ ²⁻ exclusively as mer [M(HIm)₃O₃]-type isomers. The unit cell of these isostructural complexes (monoclinic crystal system P2₁ /n) contains two independent helixes, left- and right handed, stabilized by intrahelical and interhelical hydrogen bonding and π–π interaction between pairs of the imidazole rings from neighbouring helixes. The Raman spectra at 77 K of 1 and 2 deconvoluted into lorentzian components revealed the block-type polymeric structure of the complexes. Moreover, the solution studies at millimolar concentrations of 1 and 2 indicated their complete decomposition in water. Four K electronic spectral analysis of the crystals (band deconvolution into gaussian components) enhanced with the data obtained in the polarized light allowed for assignment of the bands to the respective d–d transition (D_4h symmetry). It was found that the metallic centres are independently absorbing species, which supports the suggestion of a block-type structure of the polymers. The respective crystal field parameters for Co and Ni were calculated.     

On the Durrmeyer-type modification of some discrete approximation operators

In [10], for continuous functionsf from the domain of certain discrete operatorsL _n the inequalities are proved concerning the modulus of continuity ofL _nf. Here we present analogues of the results obtained for the Durrmeyer-type modification $\tilde L_n $ ofL _n. Moreover, we give the estimates of the rate of convergence of $\tilde L_n f$ in Hölder-type norms     

Interaction of water with the regenerated cellulose membrane studied by DSC

One to three endothermal peaks atributted to melting of bulk and interfacial water were observed by DSC in the regenerated cellulose — water system. The profiles of thermal effects depend on water content, time of conditioning, film pretreatment and the conditions applied during the preceding freezing-thawing cycles. The occurrence might be deduced of melting-crystallisation processes. A large amount of non-freezable strongly bounded water was also detected. Although cellulose absorbs water quickly after immersion, the structural changes consisting on ordering of polymer fraction occur during further conditioning due to increase in strength of water binding. Using the membranes in the separation module at 90°C causes weakening of these bonds. Differences between interaction of particular cellulose films with water can be detected during the first, the second and the third heating. This revised version was published online in July 2006 with corrections to the Cover Date.     

Kinetics and mechanism of the phenolysis of asymmetric diaryl carbonates

The reactions 4-methylphenyl 4-nitrophenyl carbonate (MPNPC), 4-chlorophenyl 4-nitrophenyl carbonate (CIPNPC), 4-methylphenyl 2,4-dinitrophenyl carbonate (MPDNPC), and 4-chlorophenyl 2,4-dinitrophenyl carbonate (CIPDNPC) with a homogeneous series of phenoxide anions are subjected to a kinetic investigation in aqueous solution (25.0 degrees C, ionic strength 0.2 M (KCI)). Under an excess of phenoxide with respect to the substrate, all of these reactions obey pseudo-first-order kinetics and are first order in phenoxide. The Br?nsted-type plots for the nucleophilic rate constants (k(N)) are linear, with slopes beta = 0.48 (MPNPC), 0.67 (ClPNPC), 0.41 (MPDNPC), and 0.32 (ClPDNPC). The magnitude of these slopes and the absence of a curvature in the Br?nsted plot at pK(a) = 7.1 for the CIPNPC reactions are consistent with concerted mechanisms (one step). The carbonates MPDNPC and ClPDNPC are more reactive than MPNPC and CIPNPC, respectively, toward phenoxide nucleophiles. This can be explained by the presence of a second nitro group in the nucleofuge of the dinitro derivatives, which (i) leaves their carbonyl carbon more positively charged, making them better electrophiles, and (ii) makes 2,4-dinitrophenoxide a better leaving group than 4-nitrophenoxide. The 4-chloro derivatives are more reactive than the corresponding 4-methyl derivatives. This should be due to the greater electron withdrawal of 4-chloro than 4-methyl, which makes the former carbonyl more electrophilic. Comparison of the concerted phenolysis of MPNPC with the stepwise reactions of secondary alicyclic amines with the same substrate indicates that substitution of a secondary alicyclic amine group in a zwitterionic tetrahedral intermediate by a phenoxy group greatly destabilizes the intermediate. An equation is deduced for log k(N) in terms of the basicity of the nucleophile, the nonleaving moiety, and the leaving group. This equation shows that for these reactions, the sensitivity of log k(N) to the basicity of the nonleaving moiety (beta(nlg) = -0.27) is very similar to that of the nucleofuge (beta(lg) = -0.25).     

An efficient reagent for the phosphorylation of deoxyribonucleosides, DNA oligonucleotides, and their thermolytic analogues

[reaction: see text] The phosphoramidite 11 was prepared in three steps from methyl 2-mercaptoacetate and demonstrated efficiency in the synthesis of conventional 5'-/3'-phosphate/thiophosphate monoester derivatives of 2'-deoxyribonucleosides and DNA oligonucleotides. Moreover, the use of 11 has enabled the preparation of the dinucleoside phosphorothioate analogue 26 in high yields (>95%) with minimal cleavage (<2%) of the thermolytic thiophosphate protecting group.