Hydrazones Possessing a Phenyl-1,2,3,4-tetrahydroquinoline Moiety as Hole Transporting Materials

Hydrazones containing 1-phenyl-1,2,3,4-tetrahydroquinoline units were synthesized starting from diphenylamine. These compounds were found to constitute novel hole transporting materials and were characterized by the time of flight method. The hole drift mobility in these compounds exceeds 10⁻⁶ cm² V⁻¹ s⁻¹ at an electric field of 10⁶ V cm⁻¹.     

2,2,5,5-tetramethylpyrrolidin-3-one-1-sulfinyl group for 5'-hydroxyl protection of deoxyribonucleoside phosphoramidites in the solid-phase preparation of DNA oligonucleotides

Several nitrogen-sulfur reagents have been investigated as potential 5'-hydroxyl protecting groups for deoxyribonucleoside phosphoramidites to improve the synthesis of oligonucleotides on glass microarrays. Out of the nitrogen-sulfur-based protecting groups so far investigated, the 2,2,5,5-tetramethylpyrrolidin-3-one-1-sulfinyl group exhibited near optimal properties for 5'-hydroxyl protection by virtue of the mildness of its deprotection conditions. Specifically, the iterative cleavage of a terminal 5'-sulfamidite group in the synthesis of 5'-d(ATCCGTAGCCAAGGTCATGT) on controlled-pore glass is efficiently accomplished by treatment with iodine in the presence of an acidic salt. Hydrolysis of the oligonucleotide to its 2'-deoxyribonucleosides upon exposure to snake venom phosphodiesterase and bacterial alkaline phosphatase did not reveal the formation of any nucleobase adducts or other modifications. These findings indicate that the 2,2,5,5-tetramethylpyrrolidin-3-one-1-sulfinyl group for 5'-hydroxyl protection of phosphoramidites, such as 10a-d, may lead to the production of oligonucleotide microarrays exhibiting enhanced specificity and sensitivity in the detection of nucleic acid targets.     

Studies on the Distribution of Phenoxyacetic Acid in Two-Phase Systems: <Emphasis Type="Italic">n</Emphasis>-Aliphatic Hydrocarbon – Water

Summary. Phenoxyacetic acid distribution in two-phase systems n-aliphatic hydrocarbon (C₅–C₈) – water and its dimerization in organic phase were investigated. The values of distribution coefficient (D _HR), distribution constant (K _D), and dimerization constant (K _dim) of acid were obtained. The empirical correlations of these quantities with Hildebrand solubility parameter of organic solvents were established. The influence of pH of the aqueous phase as well as the polarity of the applied organic solvents on phenoxyacetic acid physical chemistry in the two-phase systems was described.     

Regioselective N-vinylation of cyclic thionocarbamates through a vinyl bis-sulfone methodology

A vinyl bis-sulfone Michael type approach towards heteroatom vinylation was applied on nitrogen derivatives. Cyclic thionocarbamates--mainly 1,3-oxazolidine-2-thiones--were converted into their N-vinyl counterparts; the procedure proved particularly efficient in the case of carbohydrate-derived complex structures.     

Binary and ternary chromium(III) complexes with cellular reductants and DNA components isolated from redox type systems. Part 1. Chromium(VI)–cysteine–adenine (adenosine,ATP)

The reduction of CrO₃ with an excess of L-cysteine and its interaction with DNA fragments (adenine, adenosine) and ATP nucleotide was studied by analysis of the isolated solid products. The precipitates were characterised by elemental analyses, FAB mass spectral data, spectroscopic methods (u.v.–vis., f.i.r., i.r.) and magnetic measurements. The Cr^III complexes obtained appear to be various Cr^III cysteinate and adenine or ATP (but not adenosine) ternary species of the addition type bound through the hydrogen bonding network.     

Synthesis and anticonvulsant activity of new fluorinated N-phenyl- and N-benzyl-2-azaspiro[4.4]nonane- and [4.5]decane-1,3-dione derivatives: Part III

A series of N-phenyl- and N-benzyl-2-azaspiro[4.4]nonane- and [4.5]decane-1,3-diones containing a fluoro or trifluoromethyl substituents at the aryl ring was synthesized and tested for their anticonvulsant activity in the maximal electroshock (MES) and subcutaneous metrazole (sc.Met) tests. Among them, the most active were N-benzyl derivatives with fluoro and trifluoromethyl substituents especially at position-2 of the aryl moiety. The introduction of the phenyl ring at the imide nitrogen atom resulted in less active compounds. The results obtained showed that incorporation of fluoro or trifluoromethyl substituents increased the anticonvulsant activity in comparison to respective chloro, methoxy or methyl analogues. Crystallographically obtained conformation for one active and two inactive derivatives with trifluoromethyl substituents at position-2 or -3 of phenyl ring were initially used for molecular electrostatic potentials (MEP) calculation. The MEP distribution at carbonyl oxygen atoms was different for active and inactive molecules.     

Synthese und thermische Eigenschaften von molekularen Clusterverbindungen zusammengesetzt aus Elementen der Gruppen 11‐13‐16

Syntheses and Thermal Properties of Cluster Molecules, formed from Groups 11‐13‐16 Elements In the presence of PPh₃, CuX (X = Cl, CH₃COO) or AgOC(O)C₆H₅ and GaCl₃ react in THF with S(SiMe₃)₂ or Se(SiMe₃)₂ to yield [Cu₆Ga₈Cl₄S₁₃(PPh₃)₆] ( 1 ), [Cu₆Ga₈Cl₄Se₁₃(PPh₃)₆] ( 2 ), [Ag₆Ga₈Cl₄S₁₃(PPh₃)₆] ( 4 ) and [Ag₆Ga₈Cl₄Se₁₃(PPh₃)₆] ( 5 ). The use of PⁿPr₂Ph instead of PPh₃ and subsequent layering with n‐hexane leads to the formation of the cluster [Cu₆Ga₈Cl₄Se₁₃(PⁿPr₂Ph)₁₂] ( 3a , 3b ). Reaction of CuCl, GaCl₃ and PⁿPr₃ with Se(SiMe₃)₂ in THF results in the crystallisation of the ionic cluster (HPⁿPr₃)₂[Cu₂Ga₄Cl₄Se₆(PⁿPr₃)₄] ( 6 ). The structures of 1 — 6 were determined by X‐ray single crystal structure analysis. Thermogravimetric measurements of the cluster molecules and powder diffraction patterns of the remaining powders reveal the potential use of them as single source precursor compounds for the synthesis of the related ternary solid state materials.     

Carrier influence on the paramagnetic and catalytic properties of supported titanium complexes

Alumina-silica possessing various Al₂O₃/SiO₂ ratios was used as a carrier of surface titanium complexes. The systems obtained were examined as models for the investigation of the macroligand (inorganic gel) influence on the physicochemical properties of supported transition metal complexes. The titanium complexes were prepared first by the reaction of CpTiCl₃, with the hydroxyl groups of the gel and then reduced by an excess of BuLi. The influence was established of the basic gel properties on: (a) the amount of titanium(IV) and titanium(III) complexes on the alumina-silica gel surfaces; (b) the symmetry of the surface Ti^III surface complexes; (c) the electron density around the surface-Ti^III ions, ionic or covalent bonds character in a complex; and (d) the catalytic activity in olefin hydrogenation.     

Cis-coordination of the chromate anions in helical Co/Ni block-type polymeric systems. Structural and spectroscopic characteristics of catena(μ-CrO4-O,O′)[Co(HIm)3H2O] and catena(μ-CrO4-O,O′)[Co0.43Ni0.57(HIm)3H2O]

Two polymeric complexes: catena(μ-CrO₄-O,O′)[Co(HIm)₃H₂O] (1) and catena(μ-CrO₄-O,O′)[Co_0.43Ni_0.57(HIm)₃H₂O] (2) (where HIm=imidazole) with a cis-bridging coordination mode of the CrO₄ ²⁻ anion have been synthesized and characterized by X-ray and spectroscopic methods. These crystals were isolated from nine systems of varying reagent molar ratios and three excluding anions: Cl⁻, NO₃ ⁻ and SO₄ ²⁻ exclusively as mer [M(HIm)₃O₃]-type isomers. The unit cell of these isostructural complexes (monoclinic crystal system P2₁ /n) contains two independent helixes, left- and right handed, stabilized by intrahelical and interhelical hydrogen bonding and π–π interaction between pairs of the imidazole rings from neighbouring helixes. The Raman spectra at 77 K of 1 and 2 deconvoluted into lorentzian components revealed the block-type polymeric structure of the complexes. Moreover, the solution studies at millimolar concentrations of 1 and 2 indicated their complete decomposition in water. Four K electronic spectral analysis of the crystals (band deconvolution into gaussian components) enhanced with the data obtained in the polarized light allowed for assignment of the bands to the respective d–d transition (D_4h symmetry). It was found that the metallic centres are independently absorbing species, which supports the suggestion of a block-type structure of the polymers. The respective crystal field parameters for Co and Ni were calculated.