2,2,5,5-tetramethylpyrrolidin-3-one-1-sulfinyl group for 5'-hydroxyl protection of deoxyribonucleoside phosphoramidites in the solid-phase preparation of DNA oligonucleotides

Several nitrogen-sulfur reagents have been investigated as potential 5'-hydroxyl protecting groups for deoxyribonucleoside phosphoramidites to improve the synthesis of oligonucleotides on glass microarrays. Out of the nitrogen-sulfur-based protecting groups so far investigated, the 2,2,5,5-tetramethylpyrrolidin-3-one-1-sulfinyl group exhibited near optimal properties for 5'-hydroxyl protection by virtue of the mildness of its deprotection conditions. Specifically, the iterative cleavage of a terminal 5'-sulfamidite group in the synthesis of 5'-d(ATCCGTAGCCAAGGTCATGT) on controlled-pore glass is efficiently accomplished by treatment with iodine in the presence of an acidic salt. Hydrolysis of the oligonucleotide to its 2'-deoxyribonucleosides upon exposure to snake venom phosphodiesterase and bacterial alkaline phosphatase did not reveal the formation of any nucleobase adducts or other modifications. These findings indicate that the 2,2,5,5-tetramethylpyrrolidin-3-one-1-sulfinyl group for 5'-hydroxyl protection of phosphoramidites, such as 10a-d, may lead to the production of oligonucleotide microarrays exhibiting enhanced specificity and sensitivity in the detection of nucleic acid targets.     

Dendrimeric Gd(III) complex of a monophosphinated DOTA analogue: optimizing relaxivity by reducing internal motion

A marked increase of relaxivity has been observed upon rigidifying the internal frame of Gd-containing PAMAM dendrimers: the effect has been attained by either protonation of the dendrimer or by forming supramolecular adducts with cationic polyaminoacids.     

Binary and ternary chromium(III) complexes with cellular reductants and DNA components isolated from redox type systems. Part 1. Chromium(VI)–cysteine–adenine (adenosine,ATP)

The reduction of CrO₃ with an excess of L-cysteine and its interaction with DNA fragments (adenine, adenosine) and ATP nucleotide was studied by analysis of the isolated solid products. The precipitates were characterised by elemental analyses, FAB mass spectral data, spectroscopic methods (u.v.–vis., f.i.r., i.r.) and magnetic measurements. The Cr^III complexes obtained appear to be various Cr^III cysteinate and adenine or ATP (but not adenosine) ternary species of the addition type bound through the hydrogen bonding network.     

Carrier influence on the paramagnetic and catalytic properties of supported titanium complexes

Alumina-silica possessing various Al₂O₃/SiO₂ ratios was used as a carrier of surface titanium complexes. The systems obtained were examined as models for the investigation of the macroligand (inorganic gel) influence on the physicochemical properties of supported transition metal complexes. The titanium complexes were prepared first by the reaction of CpTiCl₃, with the hydroxyl groups of the gel and then reduced by an excess of BuLi. The influence was established of the basic gel properties on: (a) the amount of titanium(IV) and titanium(III) complexes on the alumina-silica gel surfaces; (b) the symmetry of the surface Ti^III surface complexes; (c) the electron density around the surface-Ti^III ions, ionic or covalent bonds character in a complex; and (d) the catalytic activity in olefin hydrogenation.     

Cis-coordination of the chromate anions in helical Co/Ni block-type polymeric systems. Structural and spectroscopic characteristics of catena(μ-CrO4-O,O′)[Co(HIm)3H2O] and catena(μ-CrO4-O,O′)[Co0.43Ni0.57(HIm)3H2O]

Two polymeric complexes: catena(μ-CrO₄-O,O′)[Co(HIm)₃H₂O] (1) and catena(μ-CrO₄-O,O′)[Co_0.43Ni_0.57(HIm)₃H₂O] (2) (where HIm=imidazole) with a cis-bridging coordination mode of the CrO₄ ²⁻ anion have been synthesized and characterized by X-ray and spectroscopic methods. These crystals were isolated from nine systems of varying reagent molar ratios and three excluding anions: Cl⁻, NO₃ ⁻ and SO₄ ²⁻ exclusively as mer [M(HIm)₃O₃]-type isomers. The unit cell of these isostructural complexes (monoclinic crystal system P2₁ /n) contains two independent helixes, left- and right handed, stabilized by intrahelical and interhelical hydrogen bonding and π–π interaction between pairs of the imidazole rings from neighbouring helixes. The Raman spectra at 77 K of 1 and 2 deconvoluted into lorentzian components revealed the block-type polymeric structure of the complexes. Moreover, the solution studies at millimolar concentrations of 1 and 2 indicated their complete decomposition in water. Four K electronic spectral analysis of the crystals (band deconvolution into gaussian components) enhanced with the data obtained in the polarized light allowed for assignment of the bands to the respective d–d transition (D_4h symmetry). It was found that the metallic centres are independently absorbing species, which supports the suggestion of a block-type structure of the polymers. The respective crystal field parameters for Co and Ni were calculated.     

Light- and temperature-assisted spin state annealing: accessing the hidden multistability

Among responsive multistable materials, spin crossover (SCO) systems are of particular interest for stabilizing multiple spin states with various stimulus inputs and physical outputs. Here, in a 2D Hofmann-type coordination polymer, [Fe(isoq)₂{Au(CN)₂}₂] (isoq = isoquinoline), a medium-temperature annealing process is introduced after light/temperature stimulation, which accesses the hidden multistability of the spin state. With the combined effort of magnetic, crystallographic and Mössbauer spectral investigation, these distinct spin states are identified and the light- and temperature-assisted transition pathways are clarified. Such excitation-relaxation and trapping-relaxation joint mechanisms, as ingenious interplays between the kinetic and thermodynamic effects, uncover hidden possibilities for the discovery of multistable materials and the development of multistate intelligent devices.

Two new two-stage manipulation protocols, namely light- and temperature-assisted spin state annealing (LASSA/TASSA), are applied to a spin crossover coordination polymer, [Fe(isoq)₂{Au(CN)₂}₂], revealing the hidden multistability of spin states.     

X‐ray investigations of bicyclic α‐methylene‐δ‐valerolactones. V. (4aS,7R,8aR)‐7‐Isopropenyl‐4a‐methyl‐3‐methyleneperhydrochromen‐2‐one

The title compound, C₁₄H₂₀O₂, adopts a conformation in which the δ‐valerolactone and cyclohexane rings are almost coplanar with one another. The γ‐methyl substituent occupies an axial position with respect to the cyclohexane ring. The δ‐valerolactone moiety adopts an envelope arrangement, while the cyclohexane ring exists in a chair conformation.     

Propagating transverse electric and transverse magnetic modes in liquid crystal-clad planar waveguides

ABSTRACT

In a planar dielectric waveguide, weak confinement of a propagating mode in a high index core leads to a measurable evanescent interaction with the cladding. In this work, we study the effect of a reorientable anisotropic cladding on the behaviour of Transverse Electric (TE) and Transverse Magnetic (TM) mode polarisations using a liquid crystal (LC)-clad waveguide architecture. The polarised evanescent field of a guided mode interacts with a voltage-tunable birefringent LC cladding to deflect an out-coupled beam. Experimental measurements are coupled with a theoretical framework and show good consistency with simulation results. We isolate the effect of mode confinement by changing the thickness of the high index core. Interactions between the LC index ellipsoid and the mode polarisation are probed by changing the initial alignment of the LC. Finally, we examine the difference in deflection between TE and TM modes, which incorporates both a change in mode confinement and a difference in LC index components.     

Interaction of water with the regenerated cellulose membrane studied by DSC

One to three endothermal peaks atributted to melting of bulk and interfacial water were observed by DSC in the regenerated cellulose — water system. The profiles of thermal effects depend on water content, time of conditioning, film pretreatment and the conditions applied during the preceding freezing-thawing cycles. The occurrence might be deduced of melting-crystallisation processes. A large amount of non-freezable strongly bounded water was also detected. Although cellulose absorbs water quickly after immersion, the structural changes consisting on ordering of polymer fraction occur during further conditioning due to increase in strength of water binding. Using the membranes in the separation module at 90°C causes weakening of these bonds. Differences between interaction of particular cellulose films with water can be detected during the first, the second and the third heating. This revised version was published online in July 2006 with corrections to the Cover Date.