Assembling heterocycle-tethered C-glycosyl and alpha-amino acid residues via 1,3-dipolar cycloaddition reactions

The 1,3-dipolar cycloadditions of C-glycosyl nitrile oxides and acetylenes to an alkyne and an azide, respectively, bearing a masked glycinyl moiety furnished disubstituted isoxazoles and triazoles. Unveiling the glycinyl group in these cycloadducts afforded C-glycosyl alpha-amino acids in which the two bioactive entities were tethered through rigid five-membered heterocycles. Optimized entries to the same compounds involved the use of unmasked but protected alkyne- and azide-containing amino acids as the partners of 1,3-dipolar cycloadditions.     

Thermal behavior of orthorhombic polymorphs I and II of spironolactone

Investigation into the thermal behavior of orthorhombic Forms I and II of spironolactone, by means of differential scanning calorimetry and high-resolution X-ray powder diffraction, showed that Form I melts then recrystallizes into Form II at 373–393 K, i.e. in the temperature range within which high resolution X-ray powder diffration showed that Form I transforms into Form II. Refinements of the lattice parameters of the two forms indicated that Form I is denser than Form II in the range from 298 K up to the temperature at which it melts.     

Metal ion catalysis in the beta-elimination reactions of N-[2-(4-pyridyl)ethyl]quinuclidinium and N-[2-(2-pyridyl)ethyl]quinuclidinium in aqueous solution

Catalysis of the beta-elimination reaction of N-[2-(4-pyridyl)ethyl]quinuclidinium (1) and N-[2-(2-pyridyl)ethyl]quinuclidinium (2) by Zn(2+) and Cd(2+) in OH(-)/H(2)O (pH = 5.20-6.35, 50 degrees C, and mu = 1 M KCl) has been studied. In the presence of Zn(2+), the elimination reactions of both isomers occur from the Zn(2+)-complexed substrates (C). The equilibrium constants for the dissociation of the Zn(2+)-complexes are as follows: K(d) = 0.012 +/- 0.003 M (isomer 1) and K(d) = 0.065 +/- 0.020 M (isomer 2). The value of k(C)(H2O) for isomer 1 is 4.81 x 10(-6) s(-1). For isomer 2 both the rate constants for the "water" and OH(-)-induced reaction of the Zn(2+)-complexed substrate could be measured, despite the low concentration of OH(-) in the investigated reaction mixture [k(C)H2O)= 1.97 x 10(-6) s(-1) and k(C)(OH-)= 21.9 M(-1) s(-1), respectively]. The measured metal activating factor (MetAF), i.e., the reactivity ratio between the complexed and the uncomplexed substrate, is 8.1 x 10(4) for the OH(-)-induced elimination of 2. This high MetAF can be compared with the corresponding proton activating factor (Alunni, S.; Conti, A.; Palmizio Errico, R. J. Chem. Soc., Perkin Trans. 2 2000, 453), PAF = 1.5 x 10(6) and is in agreement with an E1cb irreversible mechanism (A(xh)D(E)* + D(N)) (Guthrie, R. D.; Jencks, W. P. Acc. Chem. Res. 1989, 22, 343). A value of k(C)(H2O)>or= 23 x 10(-7) s(-1) is estimated for the Cd(2+)-complexed isomer 2, while catalysis by Cd(2+) has not been observed for isomer 1.     

Density and Volume Properties of the 2-Chloroethanol + 2-Methoxyethanol + 1,2-Dimethoxyethane Ternary Solvent System at Different Temperatures

The density of the 2-chloroethanol (CE) + 2-methoxyethanol (ME) + 1,2-dimethoxye- thane (DME) ternary mixtures has been measured at different temperatures ranging from –10 to 80^°C, and over the entire composition range. The experimental data have been used to check the validity of some relationships accounting for the dependence of the density on temperature and composition domains. Starting from the primary data, some derived quantities, such as excess molar volumes V ^E, partial molar volumes and partial excess molar volumes , have been obtained. In these mixtures, V ^E is always positive for the [CE(1) + ME(2)] binaries, while it is generally negative at all other experimental conditions, showing the greatest deviations along the binary axes corresponding to the binary subsystems in the sequence [CE(1) + DME(2)] < [CE(1) + ME(2)] < [ME(1) + DME(2)]. The results are compared and discussed to in terms of changes in molecular association and structural effects in these solvent systems.     

The acoustical characterization of orchestra platforms and uncertainty estimation of the results

Measurements have been carried out on furnished orchestra platforms in four concert halls in Italy in order to describe the sound field perceived by musicians. The heterogeneous nature of the orchestra suggested a procedure able to take into account the mutual hearing between instrumental sections. The measured parameters were the early, late and total support, the reverberation time, the early decay time and the clarity index. A part of the study has been devoted to the measurement uncertainty estimation. The source directivity and the small displacements of the microphone influence the early decay time to a great extent while the on-platform spatial variability affects both the early decay time and the clarity index. Per-section early support shows differences that render the overall spatial mean inappropriate to describe the stage as a whole. For the other parameters an overall mean platform value can instead be suitable, even though, for the case of clarity a more evident group variability is observed. The values of late support, reverberation time, early decay time and clarity index, proposed in literature as suitable measures of reverberance for musicians, are not all intercorrelated, indicating that not all these parameters can be associated to the same subjective impression.     

Exploring the Parallel G-Quadruplex Nucleic Acid World: A Spectroscopic and Computational Investigation on the Binding of the c-myc Oncogene NHE III1 Region by the Phytochemical Polydatin

Trans-polydatin (tPD), the 3-β-D-glucoside of the well-known nutraceutical trans-resveratrol, is a natural polyphenol with documented anti-cancer, anti-inflammatory, cardioprotective, and immunoregulatory effects. Considering the anticancer activity of tPD, in this work, we aimed to explore the binding properties of this natural compound with the G-quadruplex (G4) structure formed by the Pu22 [d(TGAGGGTGGGTAGGGTGGGTAA)] DNA sequence by exploiting CD spectroscopy and molecular docking simulations. Pu22 is a mutated and shorter analog of the G4-forming sequence known as Pu27 located in the promoter of the c-myc oncogene, whose overexpression triggers the metabolic changes responsible for cancer cells transformation. The binding of tPD with the parallel Pu22 G4 was confirmed by CD spectroscopy, which showed significant changes in the CD spectrum of the DNA and a slight thermal stabilization of the G4 structure. To gain a deeper insight into the structural features of the tPD-Pu22 complex, we performed an in silico molecular docking study, which indicated that the interaction of tPD with Pu22 G4 may involve partial end-stacking to the terminal G-quartet and H-bonding interactions between the sugar moiety of the ligand and deoxynucleotides not included in the G-tetrads. Finally, we compared the experimental CD profiles of Pu22 G4 with the corresponding theoretical output obtained using DichroCalc, a web-based server normally used for the prediction of proteins’ CD spectra starting from their “.pdb” file. The results indicated a good agreement between the predicted and the experimental CD spectra in terms of the spectral bands’ profile even if with a slight bathochromic shift in the positive band, suggesting the utility of this predictive tool for G4 DNA CD investigations.     

Tailored pump-probe transient spectroscopy with time-dependent density-functional theory: controlling absorption spectra

Recent advances in laser technology allow us to follow electronic motion at its natural time-scale with ultra-fast time resolution, leading the way towards attosecond physics experiments of extreme precision. In this work, we assess the use of tailored pumps in order to enhance (or reduce) some given features of the probe absorption (for example, absorption in the visible range of otherwise transparent samples). This type of manipulation of the system response could be helpful for its full characterization, since it would allow us to visualize transitions that are dark when using unshaped pulses. In order to investigate these possibilities, we perform first a theoretical analysis of the non-equilibrium response function in this context, aided by one simple numerical model of the hydrogen atom. Then, we proceed to investigate the feasibility of using time-dependent density-functional theory as a means to implement, theoretically, this absorption-optimization idea, for more complex atoms or molecules. We conclude that the proposed idea could in principle be brought to the laboratory: tailored pump pulses can excite systems into light-absorbing states. However, we also highlight the severe numerical and theoretical difficulties posed by the problem: large-scale non-equilibrium quantum dynamics are cumbersome, even with TDDFT, and the shortcomings of state-of-the-art TDDFT functionals may still be serious for these out-of-equilibrium situations.     

A Combined Kinetic and Thermodynamic Approach for the Interpretation of Continuous‐Flow Heterogeneous Catalytic Processes

The heterogeneous proline‐catalyzed aldol reaction was investigated under continuous‐flow conditions by means of a packed‐bed microreactor. Reaction‐progress kinetic analysis (RPKA) was used in combination with nonlinear chromatography for the interpretation, under synthetically relevant conditions, of important mechanistic aspects of the heterogeneous catalytic process at a molecular level. The information gathered by RPKA and nonlinear chromatography proved to be highly complementary and allowed for the assessment of optimal operating variables. In particular, the determination of the rate‐determining step was pivotal for optimizing the feed composition. On the other hand, the competitive product inhibition was responsible for the unexpected decrease in the reaction yield following an apparently obvious variation in the feed composition. The study was facilitated by a suitable 2D instrumental arrangement for simultaneous flow reaction and online flow‐injection analysis.