Density and Volume Properties of the 2-Chloroethanol + 2-Methoxyethanol + 1,2-Dimethoxyethane Ternary Solvent System at Different Temperatures

The density of the 2-chloroethanol (CE) + 2-methoxyethanol (ME) + 1,2-dimethoxye- thane (DME) ternary mixtures has been measured at different temperatures ranging from –10 to 80^°C, and over the entire composition range. The experimental data have been used to check the validity of some relationships accounting for the dependence of the density on temperature and composition domains. Starting from the primary data, some derived quantities, such as excess molar volumes V ^E, partial molar volumes and partial excess molar volumes , have been obtained. In these mixtures, V ^E is always positive for the [CE(1) + ME(2)] binaries, while it is generally negative at all other experimental conditions, showing the greatest deviations along the binary axes corresponding to the binary subsystems in the sequence [CE(1) + DME(2)] < [CE(1) + ME(2)] < [ME(1) + DME(2)]. The results are compared and discussed to in terms of changes in molecular association and structural effects in these solvent systems.     

Exploring the Parallel G-Quadruplex Nucleic Acid World: A Spectroscopic and Computational Investigation on the Binding of the c-myc Oncogene NHE III1 Region by the Phytochemical Polydatin

Trans-polydatin (tPD), the 3-β-D-glucoside of the well-known nutraceutical trans-resveratrol, is a natural polyphenol with documented anti-cancer, anti-inflammatory, cardioprotective, and immunoregulatory effects. Considering the anticancer activity of tPD, in this work, we aimed to explore the binding properties of this natural compound with the G-quadruplex (G4) structure formed by the Pu22 [d(TGAGGGTGGGTAGGGTGGGTAA)] DNA sequence by exploiting CD spectroscopy and molecular docking simulations. Pu22 is a mutated and shorter analog of the G4-forming sequence known as Pu27 located in the promoter of the c-myc oncogene, whose overexpression triggers the metabolic changes responsible for cancer cells transformation. The binding of tPD with the parallel Pu22 G4 was confirmed by CD spectroscopy, which showed significant changes in the CD spectrum of the DNA and a slight thermal stabilization of the G4 structure. To gain a deeper insight into the structural features of the tPD-Pu22 complex, we performed an in silico molecular docking study, which indicated that the interaction of tPD with Pu22 G4 may involve partial end-stacking to the terminal G-quartet and H-bonding interactions between the sugar moiety of the ligand and deoxynucleotides not included in the G-tetrads. Finally, we compared the experimental CD profiles of Pu22 G4 with the corresponding theoretical output obtained using DichroCalc, a web-based server normally used for the prediction of proteins’ CD spectra starting from their “.pdb” file. The results indicated a good agreement between the predicted and the experimental CD spectra in terms of the spectral bands’ profile even if with a slight bathochromic shift in the positive band, suggesting the utility of this predictive tool for G4 DNA CD investigations.     

Fast electrodeposition of zinc onto single zinc nanoparticles

The zinc deposition reaction onto metallic zinc has been investigated at the single particle level through the electrode-particle collision method in neutral solutions, and in respect of its dependence on the applied potential and the ionic strength of a sulphate-containing solution. Depending on the concentration of sulphate ions in solution, different amounts of metallic zinc were deposited on the single Zn nanoparticles. Specifically, insights into the electron transfer kinetics at the single particles were obtained, indicating an electrically early reactant-like transition state, which is consistent with the rate-determining partial de-hydration/de-complexation process. Such information on the reaction kinetics at the nanoscale is of vital importance for the development of more efficient and long-lasting nanostructured Zn-based negative electrodes for Zn-ion battery applications.

     

Mycotoxins in spices and culinary herbs from Italy and Tunisia

Abstract

Spices and aromatic herbs can be contaminated with mycotoxins, since of their preharvest, postharvest, and storage conditions. In this study, 112 samples of different spices and aromatic herbs were evaluated for their mycotoxins content by HPLC-MS/MS in order to highlight their possible risk linked with human use. The results showed that mycotoxins were occasionally detected only in samples of coriander, laurel, mint, rosemary, and verbena. In both geographical origins a different contamination was detected. Among the investigated mycotoxins, AFB2, AFG1, AFG2, T2 and HT2 were detected, whereas none of the samples contained AFB1 and FB1. The co-occurrence of two toxins were observed for some samples of rosemary and verbena. This study indicates that it is essential minimize the toxins in agriculture, industry, and food-product manufacturing for the consumer health protection.     

Exploring multiple‐cumulative trapping solid‐phase microextraction for olive oil aroma profiling

Headspace solid‐phase microextraction is a solvent‐free sample preparation technique that is based on the equilibrium among a three‐phase system, i.e., sample‐headspace‐fiber. A compromise between sensitivity and extraction time is usually needed to optimize the sample throughput, especially when a large number of samples are analyzed, as usually the case in cross‐samples studies. This work explores the capability of multiple‐cumulative trapping solid‐phase microextraction on the characterization of the aroma profiling of olive oils, exploiting the automation capability of a novel headspace autosampler. It was shown that multiple‐cumulative solid‐phase microextraction has the potential to improve the overall sensitivity and burst the level of information for cross‐sample studies by using cumulative shorter extraction times.     

Synthesis and characterization of some Cr(III), Fe(III) and Zr(IV) compounds with substituted o-hydroxy benzophenone

This work presents our data concerning the synthesis and characterization of some Cr(III), Fe(III) and Zr(IV) complexes with substituted (2-hydroxy-4-methoxy-phenyl)-phenyl-methanone - C₁₄H₁₂O₃, denoted by (L1). The synthesis of these complex compounds was performed using melted urea as reaction medium. The obtained complexes have been studied by chemical analysis, IR spectroscopy, X-ray diffraction and thermogravimetric analysis. Based on the data resulting from the thermal behaviour of the studied complex compounds, the kinetic parameters of the thermal decomposition reactions have been determined. This revised version was published online in July 2006 with corrections to the Cover Date.     

Structural flexibility and role of vicinal 2-thienyl rings in 2,3-dicyano-5,6-di(2-thienyl)-1,4-pyrazine, [(CN)2Th2Pyz], its palladium(II) complex [(CN)2Th2Pyz(PdCl2)2], and the related pentametallic pyrazinoporphyrazines [(PdCl2)4Th8TPyzPzM] (M = Mg(II)(H2O), Zn(II))

The solid state and solution structure of 2,3-dicyano-5,6-di(2-thienyl)-1,4-pyrazine, [(CN)(2)Th(2)Pyz], and its Pd(II) derivative, [(CN)(2)Th(2)Pyz(PdCl(2))(2)]·H(2)O, formed by reaction of [(CN)(2)Th(2)Pyz] with [(C(6)H(5)CN)(2)PdCl(2)] were characterized by X-ray, UV-visible, (1)H and (13)C NMR, and extended X-ray absorption fine structure (EXAFS) spectral measurements. The X-ray crystal structure of [(CN)(2)Th(2)Pyz] shows the presence of one thienyl ring positioned orthogonal to the rest of the molecule, with the two vicinal thienyl rings lying orthogonal to each other in a rare arrangement. NMR studies of [(CN)(2)Th(2)Pyz] in the solid state and in solutions of dimethylformamide or dimethyl sulfoxide confirm a nonequivalence of the thienyl rings in the solid state and also in solution. EXAFS results indicate that two distinct Pd(II) coordination sites are formed at the di(2-thienyl)pyrazino moiety of [(CN)(2)Th(2)Pyz(PdCl(2))(2)]·H(2)O, with identical Pd-N(pyz) (2.03(3) ?) and Pd-Cl (2.36(3) ?) bond lengths but with different Pd-S1 (2.25(4) ?) and Pd-S2 (3.21(5) ?) bond distances in an overall asymmetric molecular framework. Density functional theory (DFT) and time-dependent DFT (TDDFT) theoretical studies also provide information about the structure and spectral behavior of the precursor and its metalated Pd(II) derivative. (1)H/(13)C NMR and UV-visible spectral measurements were also carried out on two heteropentametallic porphyrazine macrocycles which were prepared by a reaction of PdCl(2) with [Th(8)TPyzPzM] where Th(8)TPyzPz = tetrakis-2,3-[5,6-di-(2-thienyl)-pyrazino]porphyrazinato dianion and M = Mg(II)(H(2)O) or Zn(II). Spectroscopic data on the newly synthesized [(PdCl(2))(4)Th(8)TPyzPzM] compounds suggest that the binding of PdCl(2) involves coordination sites of the type S(2(th))PdCl(2) with the two thienyl rings of each di(2-thienyl)pyrazino fragment bound to Pd(II) in an equivalent manner ("th-th" coordination). This is similar to what was found for the corresponding octapyridinated analogues ("py-py" coordination).     

Strain induced strengthening of soft thermoplastic polyurethanes under cyclic deformation

We investigate the cyclic mechanical behavior in uniaxial tension of three different commercial thermoplastic polyurethane elastomers (TPU) often considered as a sustainable replacement for common filled elastomers. All TPU have similar hard segment contents and linear moduli but sensibly different large strain properties as shown by X-ray analysis. Despite these differences, we found a stiffening effect after conditioning in step cyclic loading which greatly differs from the common softening (also referred as Mullins effect) observed in chemically crosslinked filled rubbers. We propose that this self-reinforcement is related to the fragmentation of hard domains, naturally present in TPU, in smaller but more numerous sub-units that may act as new physical crosslinking points. The proposed stiffening mechanism is not dissimilar to the strain-induced crystallization observed in stretched natural rubber, but it presents a persistent nature. In particular, it may cause a local reinforcement where an inhomogeneous strain field is present, as is the case of a crack propagating in cyclic fatigue, providing a potential explanation for the well-known toughness and wear resistance of TPU.