Functional Binding Surface of a β‐Hairpin VEGF Receptor Targeting Peptide Determined by NMR Spectroscopy in Living Cells

In this study, the functional interaction of HPLW peptide with VEGFR2 (Vascular Endothelial Growth Factor Receptor 2) was determined by using fast ¹⁵N‐edited NMR spectroscopic experiments. To this aim, ¹⁵N uniformly labelled HPLW has been added to Porcine Aortic Endothelial Cells. The acquisition of isotope‐edited NMR spectroscopic experiments, including ¹⁵N relaxation measurements, allowed a precise characterization of the in‐cell HPLW epitope recognized by VEGFR2.     

Cu+(H2) and Na+(H2) adducts in exchanged ZSM-5 zeolites

Cu(I) ions in Cu-ZSM-5 form Cu+(H2) complexes, stable at room temperature and sub-atmospheric H2 pressure, which do not have any homogeneous analogue except for matrix-isolated [Cu(eta2-H2)Cl]. Comparison with the unstable Na+(H2) adducts formed in the parent Na-ZSM-5 zeolite allow the conclusion that the Cu(I)/H2 bond is governed by sigma-pi overlap forces.     

Exploring the Parallel G-Quadruplex Nucleic Acid World: A Spectroscopic and Computational Investigation on the Binding of the c-myc Oncogene NHE III1 Region by the Phytochemical Polydatin

Trans-polydatin (tPD), the 3-β-D-glucoside of the well-known nutraceutical trans-resveratrol, is a natural polyphenol with documented anti-cancer, anti-inflammatory, cardioprotective, and immunoregulatory effects. Considering the anticancer activity of tPD, in this work, we aimed to explore the binding properties of this natural compound with the G-quadruplex (G4) structure formed by the Pu22 [d(TGAGGGTGGGTAGGGTGGGTAA)] DNA sequence by exploiting CD spectroscopy and molecular docking simulations. Pu22 is a mutated and shorter analog of the G4-forming sequence known as Pu27 located in the promoter of the c-myc oncogene, whose overexpression triggers the metabolic changes responsible for cancer cells transformation. The binding of tPD with the parallel Pu22 G4 was confirmed by CD spectroscopy, which showed significant changes in the CD spectrum of the DNA and a slight thermal stabilization of the G4 structure. To gain a deeper insight into the structural features of the tPD-Pu22 complex, we performed an in silico molecular docking study, which indicated that the interaction of tPD with Pu22 G4 may involve partial end-stacking to the terminal G-quartet and H-bonding interactions between the sugar moiety of the ligand and deoxynucleotides not included in the G-tetrads. Finally, we compared the experimental CD profiles of Pu22 G4 with the corresponding theoretical output obtained using DichroCalc, a web-based server normally used for the prediction of proteins’ CD spectra starting from their “.pdb” file. The results indicated a good agreement between the predicted and the experimental CD spectra in terms of the spectral bands’ profile even if with a slight bathochromic shift in the positive band, suggesting the utility of this predictive tool for G4 DNA CD investigations.     

Layered-double-hydroxide-modified electrodes: electroanalytical applications

Two-dimensional inorganic solids, such as layered double hydroxides (LDHs), also defined as anionic clays, have open structures and unique anion-exchange properties which make them very appropriate materials for the immobilization of anions and biomolecules that often bear an overall negative charge. This review aims to describe the important aspects and new developments of electrochemical sensors and biosensors based on LDHs, evidencing the research from our own laboratory and other groups. It is intended to provide an overview of the various types of chemically modified electrodes that have been developed with these 2D layered materials, along with the significant advances made over the last several years. In particular, we report the main methods used for the deposition of LDH films on different substrates, the conductive properties of these materials, the possibility to use them in the development of membranes for potentiometric anion analysis, the early analytical applications of chemically modified electrodes based on the ability of LDHs to preconcentrate redox-active anions and finally the most recent applications exploiting their electrocatalytic properties. Another promising application field of LDHs, when they are employed as host structures for enzymes, is biosensing, which is described considering glucose as an example.

A multi-technique nondestructive approach for characterizing the state of conservation of ancient bookbindings

Journal of Thermal Analysis and Calorimetry - The aim of this work is to evaluate the potentiality of a multi-technique nondestructive approach for characterizing the state of conservation of...     

Electrochemical Approach for the Production of Layered Double Hydroxides with a Well-Defined Co/MeIII Ratio

Layered double hydroxides (LDHs) have been widely studied for their plethora of fascinating features and applications. The potentiostatic electrodeposition of LDHs has been extensively applied in the literature as a fast and direct method to substitute classical chemical routes. However, the electrochemical approach does not usually allow for a fine control of the M^II/M^III ratio in the synthesized material. By employing a recently proposed potentiodynamic method, LDH films of controlled composition are herein prepared with good reproducibility, using different ratios of the trivalent (Fe or Al) to bivalent (Co) cations in the electrolytic solution. All the obtained materials are shown to be effective oxygen evolution reaction (OER) catalysts, and are thoroughly characterized by a multi-technique approach, including FE-SEM, XRD, Raman, AES and a wide range of electrochemical procedures.     

Amperometric Glucose Biosensors Based on Glassy Carbon and SWCNT‐Modified Glassy Carbon Electrodes

Different carbonaceous materials, such as single‐walled carbon nanotubes (SWCNTs) and glassy carbon submitted to an electrochemical activation at +1.80 V (vs. SCE) for 900 s, have been used with the aim of comparing their performances in the development of enzyme electrodes. Commercial SWCNTs have been pretreated with 2.2 M HNO₃ for 20 h prior to use. The utility of activated GC as promising material for amperometric oxidase‐based biosensors has been confirmed. With glucose oxidase (GOx) as a model enzyme, glucose was efficiently detected up to 1 mM without the use of a mediator. Both electrodes operated in stirred solutions of 0.1 M phosphate buffer (pH 5.5), containing dissolved oxygen, at a potential of ?0.40 V vs. SCE. Although the performances of the two carbonaceous materials were comparable, the biosensors based on activated GC were characterized by a practically unchanged response 40 days after the fabrication, a better signal to noise ratio, and a little worse sensitivity. In addition, the preparation procedure of such biosensors was more simple, rapid and reproducible.     

An Experimental Evidence of a Metal−Metal Bond in μ‐Carbonylhexacarbonyl[μ‐(5‐oxofuran‐2(5H)‐ylidene‐κC,κC)]‐dicobalt(Co−Co)[Co2(CO)6(μ‐CO)(μ‐C4O2H2)]

The orthorhombic crystal structure of [Co₂(CO)₆(μ‐CO)(μ‐C₄O₂H₂)] ( 1 ) was determined at 150 K (Fig. 1). Two C−H⋅⋅⋅O bonds connect the molecules, forming waving ribbons along the b axis. The experimental electron density, determined with the aspherical‐atom formalism, was analyzed with the topological theory of molecular structure. The presence of the Co−Co bond critical point indicates for the first time the existence of a metal−metal bond in a system with bridged ligands. The bond critical properties of the intramolecular bonds and of the intermolecular interactions show features similar to those found in [Mn₂(CO)₁₀], confirming our previously established bonding classification for organometallic and coordination compounds.     

Affinity Chromatography-Based Assays for the Screening of Potential Ligands Selective for G-Quadruplex Structures

DNA G-quadruplexes (G4s) are key structures for the development of targeted anticancer therapies. In this context, ligands selectively interacting with G4s can represent valuable anticancer drugs. Aiming at speeding up the identification of G4-targeting synthetic or natural compounds, we developed an affinity chromatography-based assay, named G-quadruplex on Oligo Affinity Support (G4-OAS), by synthesizing G4-forming sequences on commercially available polystyrene OAS. Then, due to unspecific binding of several hydrophobic ligands on nude OAS, we moved to Controlled Pore Glass (CPG). We thus conceived an ad hoc functionalized, universal support on which both the on-support elongation and deprotection of the G4-forming oligonucleotides can be performed, along with the successive affinity chromatography-based assay, renamed as G-quadruplex on Controlled Pore Glass (G4-CPG) assay. Here we describe these assays and their applications to the screening of several libraries of chemically different putative G4 ligands. Finally, ongoing studies and outlook of our G4-CPG assay are reported.     

Understanding deadlock and livelock behaviors in Hybrid Control Systems

This paper introduces a formal definition and a categorization of Deadlock and Livelock behaviors for a general class of deterministic Hybrid Control Systems (HCS), thus extending the classical notion known for (uncontrolled) discrete transition systems. This characterization hinges on three important aspects: (1) the concept of composition (or interconnection) of HCSs; (2) the notion of control-dependent specification, and that of composition of specifications; (3) the dynamical structure of an HCS and its related behaviors. The first notion is introduced in a novel manner, by including aspects from the literature of discrete transition systems, as well as accounting for classical concepts such as that of feedback interconnection of dynamical systems. The second point allows us to formally express general properties that are of interest from a systems and control theory perspective. The third part discriminates between the different and possibly pathological behaviors that are characteristic to HCSs. After commenting on the issues of Deadlock and Livelock prevention and verification, the article concludes with two case studies.