Probing hydrogen bonding in a DNA triple helix using protium-deuterium fractionation factors

In this communication we report protium-deuterium fractionation factors for the intramolecular triple helix formed by the DNA oligonucleotide 5'-d(AGAGAGAACCCCTTCTCTCTTTTTCTCTCTT)-3'. The fractionation factors of individual Watson-Crick and Hoogsteen hydrogen bonds in the structure are measured by NMR spectroscopy. The results show that, in contrast to proteins, the fractionation factors are all equal or lower than unity. On the average, the values of the fractionation factors are centered between 0.6 and 0.8, and no significant differences are observed between Hoogsteen and Watson-Crick hydrogen bonds. Deviations from the average are observed for the 5'-end region of the molecule where a base triad is absent and the structure is strained by the intramolecular folding of the DNA strand.     

HPLC monitored synthesis of R2NCH2 substituted benzene derivatives used as (C,N)-ligands for organometallic compounds

2-(Diethylaminomethyl)phenyl bromide and 1,3-bis(dimethylaminomethyl)-benzene, useful ligands for the synthesis of hypervalent organometallic compounds, were prepared and characterized by NMR (¹H, ¹³C, 2D experiments) spectroscopy. Their synthesis was monitored by the HPLC method. The compounds were eluted on a Nucleosil 120 Si column (5 μm, 25×0.4 cm) with n-hexane at room temperature using a 1.0 ml/min flow-rate. The maximum values of absorbance for the studied compounds, excepting the diethylamine, were located in a narrow range around 212 nm, the wavelength used for their UV detection. The diethylamine was detected at 190 nm. The calibration curves are straight lines with correlation factors r>0.995. The HPLC data are in good agreement with those provided by NMR spectroscopy.     

Bioactive Polymers. XXVI. Immobilization of Pepsin on Biozan R

Pepsin was immobilized on BIOZAN R (Hercules) with dicyclohexylcarbodiimide as activator. The reaction product obtained has a protein content of 35–110 mg/g of polymer and a proteolytic activity between 20.85–28.75 μmol tyrosine/L·min·g of polymer). The coupling reaction rate is maximum under the following conditions: pepsin/BIOZAN R ratio = 0.52 g/g, DCCI/BIOZAN R ratio = 0.2 g/g, pH = 3.4, reaction time = 4 h.     

High resolution spectroscopy of (lambda)(12)B by electroproduction

An experiment measuring electroproduction of hypernuclei has been performed in hall A at Jefferson Lab on a 12C target. In order to increase counting rates and provide unambiguous kaon identification two superconducting septum magnets and a ring imaging Cherenkov detector were added to the hall A standard equipment. An unprecedented energy resolution of less than 700 keV FWHM has been achieved. Thus, the observed (Lambda)(12)B spectrum shows for the first time identifiable strength in the core-excited region between the ground-state s-wave Lambda peak and the 11 MeV p-wave Lambda peak.     

Planar Dielectrochromatography on Non-Wetted Thin Layers

JPC – Journal of Planar Chromatography – Modern TLC - Some of the physical properties of dielectric liquids are influenced by electric fields. Interesting results were obtained in this...     

Bernstein-Walsh inequalities and the exponential curve in

It is shown that for the pluripolar set in there is a global Bernstein-Walsh inequality: If is a polynomial of degree on and on , this inequality gives an upper bound for which grows like . The result is used to obtain sharp estimates for .

     

Surfaces Generation by Blending Interpolation on a Triangle with One Curved Side

We use some interpolation operators and some Bernstein type operators for construction of surfaces which satisfy some given conditions.