排序方式: 共有42条查询结果,搜索用时 15 毫秒
1.
Parameterization of OPLS-AA force field for the conformational analysis of macrocyclic polyketides 总被引:1,自引:0,他引:1
The parameters for the OPLS-AA potential energy function have been extended to include some functional groups that are present in macrocyclic polyketides. Existing OPLS-AA torsional parameters for alkanes, alcohols, ethers, hemiacetals, esters, and ketoamides were improved based on MP2/aug-cc-pVTZ and MP2/aug-cc-pVDZ calculations. Nonbonded parameters for the sp(3) carbon and oxygen atoms were refined using Monte Carlo simulations of bulk liquids. The resulting force field predicts conformer energies and torsional barriers of alkanes, alcohols, ethers, and hemiacetals with an overall RMS deviation of 0.40 kcal/mol as compared to reference data. Densities of 19 bulk liquids are predicted with an average error of 1.1%, and heats of vaporization are reproduced within 2.4% of experimental values. The force field was used to perform conformational analysis of smaller analogs of the macrocyclic polyketide drug FK506. Structures that adopted low-energy conformations similar to that of bound FK506 were identified. The results show that a linker of four ketide units constitutes the shortest effector domain that allows binding of the ketide drugs to FKBP proteins. It is proposed that the exact chemical makeup of the effector domain has little influence on the conformational preference of tetraketides. 相似文献
2.
Molecular dynamics simulations have been performed to gain insights into the catalytic mechanism of the hydrolysis of epoxides to vicinal diols by soluble epoxide hydrolase (sEH). The binding of a substrate, 1S,2S-trans-methylstyrene oxide, was studied in two conformations in the active site of the enzyme. It was found that only one is likely to be found in the active enzyme. In the preferred conformation the phenyl group of the substrate is pi-sandwiched between two aromatic residues, Tyr381 and His523, whereas the other conformation is pi-stacked with only one aromatic residue, Trp334. Two simulations were carried out to 1 ns for each conformation to evaluate the protonation state of active site residue His523. It was found that a protonated histidine is essential for keeping the active site from being disrupted. Long time scale, 4 ns, molecular dynamics simulation was done for the structure with the most likely combination of binding conformation and protonation state of His523. Near Attack Conformers (NACs) are present 5.3% of the time and nucleophilic attack on either epoxide carbon atom, approximately 75% on C(1) and approximately 25% on C(2), is found. A maximum of one hydrogen bond between the epoxide oxygen and either of the active site tyrosines, Tyr465 and Tyr381, is present, in agreement with experimental mutagenesis results that reveal a slight loss in activity if one tyrosine is mutated and essential loss of all activity upon double mutation of the two tyrosines in question. It was found that a hydrogen bond from Tyr465 to the substrate oxygen is essential for controlling the regioselectivity of the reaction. Furthermore, a relationship between the presence of this hydrogen bond and the separation of reactants was found. Two groups of amino acid segments were identified each as moving collectively. Furthermore, an overall anti-correlation was found between the movements of these two individually collectively moving groups, made up by parts of the cap-region, including the two tyrosines, and the site of the catalytic triad, respectively. This overall anti-correlated collective domain motion is, perhaps, involved in the conversion of E.NAC to E.TS. 相似文献
3.
Ab initio and density functional calculations have been performed to gain a better understanding of the epoxide ring-opening reaction catalyzed by epoxide hydrolase. The S(N)2 reaction of acetate with 1S,2S-trans-2-methylstyrene oxide to provide the corresponding diol acetate ester was studied with and without general-acid catalysis. MP2 and DFT (B3LYP) calculations predict, for the noncatalyzed reaction, a central barrier of approximately 20-21 kcal/mol separating the reactants from products depending on which carbon center in the epoxide is undergoing attack. From these gas-phase reactions the immediate alkoxide products are not energetically far below their associated transition states such that the reaction is predicted to be endothermic. Inclusion of aqueous solvation effects via a polarizable continuum model predicts the activation barrier to increase by almost 10 kcal/mol due to the solvation of the acetate ion nucleophile. The activation barrier for the epoxide ring-opening reaction is reduced to approximately 10 kcal/mol when phenol, as the general-acid catalyst, is included in the gas-phase calculations. This is due to the immediate product being the neutral ester rather than the corresponding alkoxide. The transition state in the general-acid-catalyzed reaction is earlier than that for the noncatalyzed reaction and the reaction is highly exothermic. Molecular mechanics calculations of 1S,2S-trans-2-methylstyrene oxide in the active site of murine epoxide hydrolase show two possible binding conformations. Both conformers have the epoxide oxygen forming hydrogen bonds with the acidic hydrogens of the catalytic tyrosines (Tyr381 and Tyr465). These two conformations likely lead to different products since the nucleophile (Asp333-CO(2)(-)) is positioned to react with either carbon center in the epoxide. 相似文献
4.
[reaction: see text] Replacement of the negatively charged phosphodiester linkages of RNA with positively charged guanidinium linkages provides the polycationic ribonucleic guanidine (RNG). RNG is anticipated to bind strongly to target DNA/RNA through the specific interactions of nucleobases and the attractive electrostatic interactions of backbones. Preparation of building blocks and the solid-phase synthesis of RNG are reported. Both trimeric and pentameric uridyl RNG have been synthesized. 相似文献
5.
Deoxynucleic guanidine (DNG), a DNA analogue in which positively charged guanidine replaces the phosphodiester linkages, tethering to Hoechst 33258 fluorophore by varying lengths has been synthesized. A pentameric thymidine DNG was synthesized on solid phase in the 3' --> 5' direction that allowed stepwise incorporation of straight chain amino acid linkers and a bis-benzimidazole (Hoechst 33258) ligand at the 5'-terminus using PyBOP/HOBt chemistry. The stability of (DNA)(2).DNG-H triplexes and DNA.DNG-H duplexes formed by DNG and DNG-Hoechst 33258 (DNG-H) conjugates with 30-mer double-strand (ds) DNA, d(CGCCGCGCGCGCGAAAAACCCGGCGCGCGC)/d(GCGGCGCGCGCGCTTTTTGGGCCGCGCGCG), and single-strand (ss) DNA, 5'-CGCCGCGCGCGCGAAAAACCCGGCGCGCGC-3', respectively, has been evaluated by thermal melting and fluorescence emission experiments. The presence of tethered Hoechst ligand in the 5'-terminus of the DNG enhances the (DNA)(2).DNG-H triplex stability by a DeltaT(m) of 13 degrees C. The fluorescence emission studies of (DNA)(2).DNG-H triplex complexes show that the DNG moiety of the conjugates bind in the major groove while the Hoechst ligand resides in the A:T rich minor groove of dsDNA. A single G:C base pair mismatch in the target site decreases the (DNA)(2).DNG triplex stability by 11 degrees C, whereas (DNA)(2).DNG-H triplex stability was decreased by 23 degrees C. Inversion of A:T base pair into T:A base pair in the center of the binding site, which provides a mismatch selectively for DNG moiety, decreases the triplex stability by only 5-6 degrees C. Upon hybridization of DNG-Hoechst conjugates with the 30-mer ssDNA, the DNA.DNG-H duplex exhibited significant increase in the fluorescence emission due to the binding of the tethered Hoechst ligand in the generated DNA.DNG minor groove, and the duplex stability was enhanced by DeltaT(m) of 7 degrees C. The stability of (DNA)(2).DNG triplexes and DNA.DNG duplexes is independent of pH, whereas the stability of (DNA)(2).DNG-H triplexes decreases with increase in pH. 相似文献
6.
The mechanism of action of inosine-uridine nucleoside hydrolase has been investigated by long-term molecular dynamics (MD) simulation in TIP3P water using stochastic boundary conditions. Five MD studies have been performed with enzyme substrate complex (E.S), enzyme substrate complex with protonated His241 (EH.S), enzyme transition state complex (E.TS), enzyme transition state complex with protonated His241 (EH.TS), and His241Ala transition state complex E(H241A).TS. Special attention has been given to the role of His241, which has been considered as the general acid catalyst to assist departure of the leaving nucleobase on the basis of its location in the active site in the X-ray crystal structure (). Yet on the basis of the location in the active site, Tyr229 is closer to the aniline ring of pAPIR as compared to His241. On initiation of MD simulations, His241 does not approach the nucleobase in the structures of EH.S, E.S, EH.TS, and E.TS. In the solvated enzyme, Tyr229, which is a member of the hydrogen bonding network inosine O2'.Asp14.His241.Tyr229.inosine N7, serves as a proton source to the leaving nucleobase. The loss of significant activity of His241Ala mutant is shown to be related to the disruption of the above hydrogen bonded network and the distancing of Tyr229 from inosine N7. The structures of the enzyme complexes with substrate or TS are not visibly altered on protonation of His241, a most unusual outcome. The bell-shaped pH dependence upon pK(app)'s of 7.1 and 9.1 may be attributed to the necessity of the dissociation of Asp10 or Asp15 and the acid form of Tyr229, respectively. In TS, the residue Ile81 migrated closer, whereas Arg233 moved away from the nucleobase. The probability of ribooxocarbenium ion stabilization by Asn168 and Asp14 is discussed. The Asp14-CO(2)(-) is hydrogen bonded to the ribose 2'-OH for 96% of the MD simulation time. Nucleophilic addition of water138 to ribooxocarbenium ion is suggested to be assisted by the proton shuttle from water138 --> Asp10 --> Asp15 --> water pool. An anticorrelation motion between Tyr229-OH and Asn168-OD1 in EH.S and E.S is observed. The relationship of this anticorrelated motion to mechanism, if any, deserves further exploration, perhaps the formation of a near attack conformation. 相似文献
7.
Reddy PM Jindra PT Satz AL Bruice TC 《Journal of the American Chemical Society》2003,125(26):7843-7848
A series of pyrrole, imidazole-substituted bis-benzimidazole conjugates, Py-Py-Im-gamma-biBenz, Py-Py-gamma-biBenz, Py-Im-gamma-biBenz, and Im-Py-gamma-biBenz (1-4), were prepared in an attempt to target dsDNA sequences possessing both A/T and G/C bps. The dsDNA interactions and sequence specificity of the conjugates have been characterized via spectrofluorometric titrations and thermal melting studies. All conjugates form 1:1 complexes with dsDNA at subnanomolar concentrations. The Im moiety selectively recognizes a G/C bp embedded in the A/T-rich binding site. This represents the first clear example of sequence selective recognition in a 1:1 motif.(1) The equilibrium association constant (K(1)) for complexation of a specific nine-bp dsDNA site, 5'-gcggTATGAAATTcgacg-3', by conjugate 1 is approximately 2.6 x 10(9) M(-1). Displacement of the G/C position or G/C-->A/T substitution within the nine-bp site decreases the K(1) by approximately 8-fold, whereas two continuous G/C bps decrease the K(1) by approximately 50-fold magnitude. The K(1) values for seven-bp dsDNA, 5'-gcggtaTGAAATTcgacg-3' and 5'-gcggtaCAAAATTcgacg-3', binding sites by conjugates Py-Im-gamma-biBenz (3) and Im-Py-gamma-biBenz (4) are approximately 2.3 x 10(9) and approximately 1.2 x 10(9) M(-1), respectively. However, the conjugates with no Im moiety, Py-Py-gamma-biBenz (2) and Py-Py-Py-gamma-biBenz (5 and 6), are specific for seven- to nine-bp A/T-rich sites and single A/T-->G/C bp substitution within the binding site decreases the K(1) values by 1-2 orders of magnitude. 相似文献
8.
9.
10.
A computational comparison of the Diels-Alder reaction of a maleimide and an anthracene in water and the active site of the ribozyme Diels-Alderase is reported. During the course of the catalyzed reaction, the maleimide is held in the hydrophobic pocket while the anthracene approaches to the maleimide through the back passage of the active site. The active site is so narrow that the anthracene has to adopt a tilted approach angle toward maleimide. The conformation of the active site changes marginally at different states of the reaction. Active site dynamics contribution to catalysis has been ruled out. The active site stabilizes the product more than the transition state (TS). The reaction coordinates of the ribozyme reaction in TS, RC1-CD1 and RC4-CD2, are 2.35 and 2.33 A, respectively, compared to 2.37 and 2.36 A in water. The approach angle of anthracene toward maleimide is twisted by 18 degrees in the TS structure of ribozyme reaction while no twisted angle is found in TS of the reaction in water. The free energy barriers for reactions in both ribozyme and water were obtained by umbrella sampling combined with SCCDFTB/MM. The calculated free energy barriers for the ribozyme and water reactions are in good agreement with the experimental values. As expected, Mulliken charges of the atoms involved in the ribozyme reaction change in a similar manner as that of the reaction in water. The proficiency of the Diels-Alder ribozyme reaction originates from the active site holding the two reactants in reactive conformations, in which the reacting atoms are brought together in van der Waals distances and reactants approach to each other at an appropriate angle. 相似文献