Alkaloids and Colon Cancer: Molecular Mechanisms and Therapeutic Implications for Cell Cycle Arrest

Cancer is the second most fatal disease worldwide, with colon cancer being the third most prevalent and fatal form of cancer in several Western countries. The risk of acquisition of resistance to chemotherapy remains a significant hurdle in the management of various types of cancer, especially colon cancer. Therefore, it is essential to develop alternative treatment modalities. Naturally occurring alkaloids have been shown to regulate various mechanistic pathways linked to cell proliferation, cell cycle, and metastasis. This review aims to shed light on the potential of alkaloids as anti-colon-cancer chemotherapy agents that can modulate or arrest the cell cycle. Preclinical investigated alkaloids have shown anti-colon cancer activities and inhibition of cancer cell proliferation via cell cycle arrest at different stages, suggesting that alkaloids may have the potential to act as anticancer molecules.     

Development of a Genus-Universal Nucleotide Signature for the Identification and Supervision of Ephedra-Containing Products

Ephedra plants generally contain ephedrine alkaloids, which are the critical precursor compounds of methamphetamine (METH). METH could cause serious physical and mental damage, and therefore Ephedra materials are strictly in supervision internationally. However, unlawful utilization of Ephedra herbs and its products still exist. Thus, it is imperative to establish a universal method for monitoring Ephedra ingredients in complex mixtures and processed products. In this study, 224 ITS2 sequences representing 59 taxa within Ephedra were collected, and a 23-bp genus-level nucleotide signature (GTCCGGTCCGCCTCGGCGGTGCG) was developed for the identification of the whole genus. The specific primers MH-1F/1R were designed, and 125 individuals of twelve Ephedra species/varieties were gathered for applicability verification of the nucleotide signature. Additionally, seven batches of Chinese patent medicines containing Ephedra herbs were used to test the application of the nucleotide signature in complex and highly processed materials. The results demonstrated that the 23-bp molecular marker was unique to Ephedra and conserved within the genus. It can be successfully utilized for the detection of Ephedra components in complex preparations and processed products with severe DNA degradation. The method developed in this study could undoubtedly serve as a strong support for the supervision of illegal circulation of Ephedra-containing products.     

C, N CPMAS NMR and GIAO DFT calculations of stereoisomeric oxindole alkaloids from Cat's Claw (Uncaria tomentosa)

Oxindole alkaloids, isolated from the bark of Uncaria tomentosa [Willd. ex Schult.] Rubiaceae, are considered to be responsible for the biological activity of this herb. Five pentacyclic and two tetracyclic alkaloids were studied by solid-state NMR and theoretical GIAO DFT methods. The ¹³C and ¹⁵N CPMAS NMR spectra were recorded for mitraphylline, isomitraphylline, pteropodine (uncarine C), isopteropodine (uncarine E), speciophylline (uncarine D), rhynchophylline and isorhynchophylline. Theoretical GIAO DFT calculations of shielding constants provide arguments for identification of asymmetric centers and proper assignment of NMR spectra. These alkaloids are 7R/7S and 20R/20S stereoisomeric pairs. Based on the ¹³C CP MAS chemical shifts the 7S alkaloids (δ C3 70–71 ppm) can be easily and conveniently distinguished from 7R (δC3 74.5–74.9 ppm), also 20R (δC20 41.3–41.7 ppm) from the 20S (δC20 36.3–38.3 ppm). The epiallo-type isomer (3R, 20S) of speciophylline is characterized by a larger ¹⁵N MAS chemical shift of N4 (64.6 ppm) than the allo-type (3S, 20S) of isopteropodine (δN4 53.3 ppm). ¹⁵N MAS chemical shifts of N1–H in pentacyclic alkaloids are within 131.9–140.4 ppm.     

A new erythrinan N-oxide alkaloid from Erythrina stricta

This phytochemical study of stems and leaves of Erythrina stricta led to the isolation of twenty-three alkaloids, one of them previously unreported, 11β-hydroxyerythratidine N-oxide. Their structures were elucidated on the basis of extensive 1D and 2D NMR spectroscopic analyses including HSQC, HMBC, ¹H–¹H COSY, NOESY, as well as HRESIMS data in addition to comparison with reports in the literature.     

Fused N-Heterocycles with Contiguous Stereogenic Centers Accessed by an Asymmetric Catalytic Cascade Reaction of Tertiary Enamides

We report in this article a cascade reaction strategy for the synthesis of complex N-heterocyclic compounds with contiguous and tetrasubstituted stereogenic carbons. Under the sequential catalysis of a chiral binol–Ti complex and BF₃, cyclopentanone-derived tertiary enamides undergo an enantioselective enamine addition to ketone carbonyls followed by diastereoselective trapping of the resulting acyliminiums by electron-rich aryl moieties to furnish four- and five-membered ring-fused N-heterocyclic products as the sole diastereomers in high yields with up to 99 % ee.     

Transition-Metal-Free Multiple Functionalization of Piperidines to 4-Substituted and 3,4-Disubstituted 2-Piperidinones

Remote and multiple functionalization of piperidines without the use of transition-metal catalysts and elaborate directing groups is one of the major challenges in organic synthesis. Herein is reported an unprecedented two-step protocol that enables the multiple functionalization of piperidines to either 4-substituted or trans-3,4-disubstituted 2-piperidones. First, by exploiting the duality of TEMPO reactivity, which under oxidative and thermal conditions fluctuates between cationic and persistent-radical form, a novel multiple C(sp³)-H oxidation of piperidines to α,β-unsaturated 2-piperidones was developed. Second, the intrinsic low reactivity of the unsaturated piperidones toward conjugated Grignard additions was overcome by using trimethylsilyl chloride (TMSCl) as Lewis acid. Subsequently, conjugated Grignard addition/electrophilic trapping protocol provided substituted 2-piperidone intermediates, some of which were then transformed into pharmaceutical alkaloids.     

Asymmetric Organocatalysis: The Emerging Utility of α,β‐Unsaturated Acylammonium Salts

Although acylammonium salts are well‐studied, chiral α,β‐unsaturated acylammonium salts have received much less attention. While these intermediates are convenient synthons, which are readily available from several commodity unsaturated acids and acid chlorides, and possess three reactive sites, their application in organic synthesis has been limited because of the lack of appropriate chiral Lewis bases for their generation. In recent years, the utility of chiral, unsaturated acylammonium salts has expanded considerably, thus demonstrating the unique reactivity of this intermediate leading to the development of a diverse array of catalytic, asymmetric transformations including organocascade processes. This Minireview highlights the recent and growing interest in these intermediates which might spark further research into their untapped potential for asymmetric organocascade catalysis. A cursory comparison is made to related unsaturated iminium and acylazolium intermediates.     

Synthesis,Structure and Molecular Docking of New 4,5-Dihydrothiazole Derivatives Based on 3,5-Dimethylpyrazole and Cytisine and Salsoline Alkaloids

The interaction results of 1,2-dibromo-3-isothiocyanatopropane with some pyrazoles as well as cytisine and salsoline alkaloids were presented in this paper. It was shown that the reaction resulted in one one-step and rather mild method for the preparation of the corresponding 1,3-thiazoline bromomethyl derivatives. The yield of this reaction was affected by the presence of a base and an order in which reagents were added. Molecular docking of the synthesized 1,3-thiazoline derivatives for putative antibacterial activity was carried out using the penicillin-binding target protein (PBP4) of the bacteria E. coli “Homo sapiens” and S. aureus “Homo sapiens” as an example. Molecular docking demonstrated that the compounds had insignificant binding energies at the level of selected reference drugs (Cephalotin and Chloramphenicol). The presence of natural alkaloids in the structure of thiazoline derivatives somewhat increased the affinity of these substrates for target proteins selected.     

New Diterpenoid Alkaloids from Delphinium Souliei Franch

Inourpreviouspapers'-',wehavereportedtheisolationandelucidationofaseriesofnewditerpenoidalkaloidsfromDelphinillnlsolllieiFranch.ContinuedphytochemcalinvestigationsontheconstituentsofthisplanthaveledtotheisolationoftwoothernewditerpenoidalkaloidssoulineE(l)andsoulineF(2).SoulineE(2.6mg)wasobtainedascolorlesscrystals,mpf77-78'C(fromethanol).[a]."8.0(c=0.05,CHCI;).itsmolecularformulaC,=H;,NO,wasderivedfromHkEIMS(M-f361.2613,cafe.361.2608).TheiHnmrspectrum(400MHz)exhibitedthefollowingsign…