Oriented immobilization of Desulfovibrio gigas hydrogenase onto carbon electrodes by covalent bonds for nonmediated oxidation of H2

The orientation of hydrogenase bound covalently to a pyrolytic graphite edge electrode modified with a 4-aminophenyl monolayer can be modulated via electrostatic interactions during the immobilization step. At low ionic strength and when the amino groups of the electrode surface are mostly protonated, the hydrogenase is immobilized with the negatively charged region that surrounds its 4Fe4S cluster nearer to the protein surface facing the electrode. This allows direct electron transfer between the immobilized hydrogenase and the electrode, which is observed by the strong catalytic currents measured in the presence of the H2 substrate. Therefore, a very stable enzymatic electrode is produced that catalyzes nonmediated H2 oxidation.     

2,2,5,5-tetramethylpyrrolidin-3-one-1-sulfinyl group for 5'-hydroxyl protection of deoxyribonucleoside phosphoramidites in the solid-phase preparation of DNA oligonucleotides

Several nitrogen-sulfur reagents have been investigated as potential 5'-hydroxyl protecting groups for deoxyribonucleoside phosphoramidites to improve the synthesis of oligonucleotides on glass microarrays. Out of the nitrogen-sulfur-based protecting groups so far investigated, the 2,2,5,5-tetramethylpyrrolidin-3-one-1-sulfinyl group exhibited near optimal properties for 5'-hydroxyl protection by virtue of the mildness of its deprotection conditions. Specifically, the iterative cleavage of a terminal 5'-sulfamidite group in the synthesis of 5'-d(ATCCGTAGCCAAGGTCATGT) on controlled-pore glass is efficiently accomplished by treatment with iodine in the presence of an acidic salt. Hydrolysis of the oligonucleotide to its 2'-deoxyribonucleosides upon exposure to snake venom phosphodiesterase and bacterial alkaline phosphatase did not reveal the formation of any nucleobase adducts or other modifications. These findings indicate that the 2,2,5,5-tetramethylpyrrolidin-3-one-1-sulfinyl group for 5'-hydroxyl protection of phosphoramidites, such as 10a-d, may lead to the production of oligonucleotide microarrays exhibiting enhanced specificity and sensitivity in the detection of nucleic acid targets.     

Flexible ureasil hybrids with tailored optical properties through doping with metal nanoparticles

Hybrid organic-inorganic nanocomposites containing uniform distributions of metal nanoparticles have been prepared by mixing a preformed nanoparticle colloid with the precursors of a ureasil, prior to the sol-gel transition. These nanocomposites possess not only high optical quality and optical features dictated by the size and shape of the nanoparticle dopants but also a high degree of flexibility, which can largely enhance the range of applications in practical devices. The deposition of a uniform silica shell on the nanoparticle surface prior to the sol-gel transition was found to be required to maintain the colloidal stability during the process and, thus, to retain the optical properties in the final nanocomposite material. This method can be readily extended to other materials, such as semiconductor and magnetic nanoparticles.     

Stereoselective synthesis of individual isomers of Leu-enkephalin analogues containing substituted beta-turn bicyclic dipeptide mimetics

Novel constrained beta-turn dipeptide mimetics, 8-phenyl thiaindolizidinone amino acids 3, have been synthesized stereoselectively and incorporated into Leu-enkephalin peptides as a replacement of dipeptide Gly3-Phe4 to afford four individual isomers of Leu-enkephalin analogues 6.     

Gemini-induced columnar jointing in vitreous ice. Cryo-HRSEM as a tool for discovering new colloidal morphologies

A gemini surfactant is able to promote columnar jointing in vitreous ice where long pillars, often of hexagonal cross section, are formed. This jointing is visible by cryo-high-resolution scanning electron microscopy (cryo-HRSEM), in which colloidal suspensions in bulk water are cooled rapidly in liquid ethane, thereby avoiding the potential artifacts with other types of EM. The jointing is proposed to arise from a new type of colloidal morphology where the surfactant self-assembles into hexagonal columns. Evidence for this mechanism comes from a cryo-HRSEM photo of an ice-free hexagonal "skeleton" composed of surfactant. Cryo-HRSEM, a method that is just beginning to realize its potential, would seem to have a promising future in the discovery of additional and as yet unimagined colloidal structures.     

THE EFFECTS OF THROMBOXANE INHIBITORS ON THE MICROVASCULAR AND TUMOR RESPONSE TO PHOTODYNAMIC THERAPY

Abstract— Vascular stasis and tissue ischemia are known to cause tumor cell death in several experimental models after photodynamic therapy (PDT); however, the mechanisms leading to this damage remain unclear. Because previous studies indicated that thromboxane release is implicated in vessel damage, we further examined the role of throm-boxane in PDT. Rats bearing chondrosarcoma were injected with 25 mg/kg Photofrin® (intravenously) 24 h before treatment. Light (135 J/cm ² , 630 nm) was delivered to thc tumor area after injection of one of the following inhibitors: (1) R68070: a thromboxane synthetase inhibitor; (2) SQ-29548: a thromboxane receptor antagonist; and (3) Flunarizine: an inhibitor of platelet shape change. Systemic thromboxane levels were determined. Vessel constriction and leakage were evaluated by intravital microscopy. Tumor response was assessed after treatment. Thromboxane levels were decreased more than 50% with SQ-29548 as compared to controls. Thromboxane levels in animals given R68070 and Flunarizine remained at baseline levels. SQ-29548 and R68070 reduced vessel constriction compared to controls, while Flunarizine totally prevented vessel constriction. R68070 and SQ-29548 inhibited vessel permeability compared to PDT controls; Flunarizine did not. Animals given these inhibitors showed markedly reduced tumor cure. These results indicate that the release of thromboxane is linked to the vascular response in PDT.     

Transport properties of alkyltrimethylammonium bromide surfactants in aqueous solutions

Differential mutual diffusion coefficients of n-alkyltrimethylammonium bromides [CH₃(CH₂)_n–1N(CH₃)₃Br, C_nTAB] (n=10, 12, 14, 16) have been measured in aqueous solutions at 298.15 K using a conductimetric cell and an automatic apparatus to follow diffusion. The cell is based on an open-ended capillary, and the technique follows the diffusion process by measuring the resistance of a solution inside the capillaries at various times. The electrical conductances of those solutions have also been measured to calculate the critical micellar concentration (cmc). Thermodynamic analysis of the data suggests that the free ion concentration decreases at concentrations above the cmc, in agreement with theoretical predictions. The obtained values of the micellization parameters were used to model the mutual diffusion coefficients of C_nTAB aqueous solutions.     

Detection of metal ions using ion-channel sensor based on self-assembled monolayer of thioctic acid

Gold electrodes were chemically modified with thioctic acid monolayer designed to mimic biological ion-channel membranes. The technique was then used in the determination of alkali, alkaline earth, thallium(I), and lanthanum metal cations as analytes. Cyclic voltammograms (CV) of [Fe(CN)6]³⁻ an electroactive marker, were measured in the presence of the various types of analyte cations. In the absence of the analyte cation, electrostatic repulsion between the marker anions and the carboxylate groups of the receptor monolayer hindered the approach of the marker anion to the electrode surface and hence hindered its reduction. The modified electrodes responded well to the metal cations except the alkali metal cations. The sensors could detect the trivalent cation La³⁺ at concentrations as low as 10⁻⁸ M. The response of the sensor to the metal cations increase in the order alkali metal3+ can be discriminated in the ratio 1:100. This makes it possible to determine the trivalent ion in a sample matrix containing monovalent and divalent cations. Thallium(I) ion showed marked deviation in its response as compared to monovalent ions of the alkali metals. The ion-channel sensor based on self-assembled monolayer of thioctic acid therefore offers a potential alternative technique for the selective determination of metal ions.     

Supramolecular isomerism in coordination compounds: nanoscale molecular hexagons and chains

A nanoscale supramolecular hexagon, 1, and its supramolecular isomeric chain structure, 2, have been prepared from self-assembly of 5-NO2-bdc and Cu(II) cations. The hexagon is neutral and soluble and has outer and inner diameters of 3.1 and 0.8 nm, respectively.