Development of a Genus-Universal Nucleotide Signature for the Identification and Supervision of Ephedra-Containing Products

Ephedra plants generally contain ephedrine alkaloids, which are the critical precursor compounds of methamphetamine (METH). METH could cause serious physical and mental damage, and therefore Ephedra materials are strictly in supervision internationally. However, unlawful utilization of Ephedra herbs and its products still exist. Thus, it is imperative to establish a universal method for monitoring Ephedra ingredients in complex mixtures and processed products. In this study, 224 ITS2 sequences representing 59 taxa within Ephedra were collected, and a 23-bp genus-level nucleotide signature (GTCCGGTCCGCCTCGGCGGTGCG) was developed for the identification of the whole genus. The specific primers MH-1F/1R were designed, and 125 individuals of twelve Ephedra species/varieties were gathered for applicability verification of the nucleotide signature. Additionally, seven batches of Chinese patent medicines containing Ephedra herbs were used to test the application of the nucleotide signature in complex and highly processed materials. The results demonstrated that the 23-bp molecular marker was unique to Ephedra and conserved within the genus. It can be successfully utilized for the detection of Ephedra components in complex preparations and processed products with severe DNA degradation. The method developed in this study could undoubtedly serve as a strong support for the supervision of illegal circulation of Ephedra-containing products.     

HMD-Net: A Vehicle Hazmat Marker Detection Benchmark

Vehicles carrying hazardous material (hazmat) are severe threats to the safety of highway transportation, and a model that can automatically recognize hazmat markers installed or attached on vehicles is essential for intelligent management systems. However, there is still no public dataset for benchmarking the task of hazmat marker detection. To this end, this paper releases a large-scale vehicle hazmat marker dataset named VisInt-VHM, which includes 10,000 images with a total of 20,023 hazmat markers captured under different environmental conditions from a real-world highway. Meanwhile, we provide an compact hazmat marker detection network named HMD-Net, which utilizes a revised lightweight backbone and is further compressed by channel pruning. As a consequence, the trained-model can be efficiently deployed on a resource-restricted edge device. Experimental results demonstrate that compared with some established methods such as YOLOv3, YOLOv4, their lightweight versions and popular lightweight models, HMD-Net can achieve a better trade-off between the detection accuracy and the inference speed.     

硬脂酸镉和山嵛酸镉混合LB膜的微结构

X-ray diffraction (XRD) was used to investigate the microstructure and phase separation of mixed multilayers of cadmium stearate (SA) and behenate (BA) deposited onto hydrophilic glass by the Langmuir-Blodgett technique. No unitary fatty acid diffraction peaks in the XRD spectra of the mixed LB films, which reveals that domains in these samples are small and uniform. The interplanar spacing of the mixed LB films changes with the ratio of BA to SA in a step-shaped curve, which suggests that with the changing of the ratio between BA and SA, only three kinds of ordered structure form in the mixed system, and each microstructure, in particular, the short chains against long chains meshed microstructure can be maintained in a certain ratio range . In addition, for the meshed microstructure, the alkyl chains of both SA and BA stand straight or may have exactly the same small tilted angle from the substrate normal, as is indicated by the symmetric and asymmetric stretching vibration of methylene (CH2) peaks which are at 2847.80 and 2914.37 cm-1respectively in the Fourier transform infrared (FT-IR) transmission spectra. The mixed system always goes through a longitudinal regularity decreasing process when BA/SA is out of the intermediate ratio range (BA/SA: 1/5-1/1), which is illustrated by the relative XRD intensity changing with the ratio of BA/ SA in a \W" shape. These results for the mixed LB films of BA/SA provide meaningful data for choosing the mixture ratio when fabricating composite films with special structure.     

Assembly of ferrocenylhexanethiol functionalized gold nanoparticles for ascorbic acid determination

Gold nanoparticles functionalized with self-assembled films of ferrocenylhexanethiol and mercaptoundecanoic acid (MUA) were used for the determination of ascorbic acid (AA). The modified nanoparticles (mNPs) were prepared by a combination of the modified Schifrin’s and the place-exchange methods. Well-organized films were obtained due to electrostatic attraction between the carboxy groups of MUA and cationic surface of poly(diallyldimethylammonium chloride). The mNP films are highly stable and can be exploited to fabricate an enzyme-less sensor for AA whose function is based on the highly electrocatalytic activity of ferrocene in the mNPs towards AA. The sensor was characterized by cyclic voltammetry and chronoamperometry. Under optimal conditions, the response current towards AA is proportional to its concentration in the range from 8.0 μM to 6.0 mM, with a detection limit of 0.14 μM (at a signal-to-noise ratio of 3). This work represents a simple controlled test-bed for fundamental studies on the use of self-assembled mNPs for sensor applications.     

Heat capacity and thermodynamic properties of 1-hexadecanol

Three different nitrocellulose (NC) samples produced from linters were investigated. DSC studies on the NC+sym-diethyldiphenylurea (C1) mixtures were carried out. The influence of storage time on their pore structures was examined using thermoporometry. The results led to conclusion that large pores are multiples of small ones. The parameter n was used to characterize the number of C1 molecules equivalent to NC ring. Its value for short storage time was about 9 but for longer time reached the value of 3. The influence of thermal history on the phase transition and porosity of the different nitrocellulose samples was different.     

Efficient conversion of fructose to 5-hydroxymethylfurfural over sulfated porous carbon catalyst

Sulfated porous carbon (PC-SO3H) catalyst was successfully synthesized from one-pot treatment of porous polydivinylbenzene in H2SO4 at 250 C, which exhibited very good catalytic performances in the production of 5-hydroxymethylfurfural from fructose.     

Experimental Study on Wave Characteristics of Stilling Basin with a Negative Step

Stilling basin with a negative step is an important structure in hydraulic systems, because it can avoid atomization and decrease scouring problems. Although stilling basins with a negative step have attracted much attention from researchers, few researchers have focused on the wave characteristics. In this research, an experimental study on the wave characteristics of stilling basins with a negative step was carried out. The wave height, average period, wave probability density and power spectrum along the flow direction of different stilling basins with a negative step were described based on the wave theory, and the results indicate discharge and step height have a significant effect on the wave characteristics. The relationships between the different characteristic wave heights, and the empirical formula for the relative characteristic wave height are obtained. Finally, the dimensionless standard deviation at the end of the stilling basin with a negative step is linearly related to the flow-energy ratio and the relative step height under B-jump.