Within the Ischemic Penumbra,Sub-Cellular Compartmentalization of Heat Shock Protein 70 Overlaps with Autophagy Proteins and Fails to Merge with Lysosomes

The brain area which surrounds the frankly ischemic region is named the area penumbra. In this area, most cells are spared although their oxidative metabolism is impaired. area penumbra is routinely detected by immunostaining of a molecule named Heat Shock Protein 70 (HSP70). Within the area penumbra, autophagy-related proteins also increase. Therefore, in the present study, the autophagy-related microtubule-associated protein I/II-Light Chain 3 (LC3) was investigated within the area penumbra along with HSP70. In C57 black mice, ischemia was induced by permanent occlusion of the distal part of the middle cerebral artery. Immunofluorescence and electron microscopy show that LC3 and HSP70 are overexpressed and co-localize within the area penumbra in the same cells and within similar subcellular compartments. In the area penumbra, marked loss of co-localization of HSP70 and LC3-positive autophagy vacuoles, with lysosomal-associated membrane protein 1 (LAMP1) or cathepsin-D-positive lysosome vacuoles occurs. This study indicates that, within the area penumbra, a failure of autophagolysosomes depends on defective compartmentalization of LC3, LAMP1 and cathepsin-D and a defect in merging between autophagosomes and lysosomes. Such a deleterious effect is likely to induce a depletion of autophagolysosomes and cell clearing systems, which needs to be rescued in the process of improving neuronal survival.     

Which Extraction Solvents and Methods Are More Effective in Terms of Chemical Composition and Biological Activity of Alcea fasciculiflora from Turkey?

The bioactive content, antioxidant properties, and enzyme inhibition properties of extracts of Alcea fasciculiflora from Turkey prepared with different solvents (water, methanol, ethyl acetate) and extraction methods (maceration, soxhlet, homogenizer assisted extraction, and ultrasound assisted extraction) were examined in this study. UHPLC-HRMS analysis detected or annotated a total of 50 compounds in A. fasciculiflora extracts, including 18 hydroxybenzoic and hydroxycinnamic acids, 7 Hexaric acids, 7 Coumarins, 15 Flavonoids, and 3 hydroxycinnamic acid amides. The extracts had phenolic and flavonoid levels ranging from 14.25 to 24.87 mg GAE/g and 1.68 to 25.26 mg RE/g, respectively, in the analysis. Both DPPH and ABTS tests revealed radical scavenging capabilities (between 2.63 and 35.33 mg TE/g and between 13.46 and 76.27 mg TE/g, respectively). The extracts had reducing properties (CUPRAC: 40.38–78 TE/g and FRAP: 17.51–42.58 TE/g). The extracts showed metal chelating activity (18.28–46.71 mg EDTAE/g) as well as total antioxidant capacity (phosphomolybdenum test) (0.90–2.12 mmol TE/g). DPPH, ABTS, FRAP, and metal chelating tests indicated the water extracts to be the best antioxidants, while the ethyl acetate extracts had the highest overall antioxidant capacity regardless of the extraction technique. Furthermore, anti-acetylcholinesterase activity was identified in all extracts (0.17–2.80 mg GALAE/g). The water extracts and the ultrasound-assisted ethyl acetate extract were inert against butyrylcholinesterase, but the other extracts showed anti-butyrylcholinesterase activity (1.17–5.80 mg GALAE/g). Tyrosine inhibitory action was identified in all extracts (1.79–58.93 mg KAE/g), with the most effective methanolic extracts. Only the ethyl acetate and methanolic extracts produced by maceration and homogenizer aided extraction showed glucosidase inhibition (0.11–1.11 mmol ACAE/g). These findings showed the overall bioactivity of the different extracts of A. fasciculiflora and provided an overview of the combination of solvent type and extraction method that could yield bioactive profile and pharmacological properties of interest and hence, could be a useful reference for future studies on this species.     

Optimal design of Service Overlay Networks with economic and performance constraints

In the last years, Service Overlay Networks (SONs) have emerged as a promising means to address some of the issues (e.g. end‐to‐end QoS) affecting the current Internet and to favor the development and deployment of new value‐added Internet services. The deployment of an SON is a capital‐intensive investment, since bandwidth with certain QoS guarantees must be purchased from the individual network domains through bilateral Service Level Agreements. Thus, minimizing the economic cost of the logical end‐to‐end service delivery infrastructure is one of the key objectives for the SON provider. When a SON is aimed at end‐to‐end QoS provisioning, its topology must be designed so as to also satisfy the specific requirements of QoS‐sensitive applications. This paper deals with the problem of planning the SON topology in order to take into account both cost and QoS constraints. More specifically, the paper proposes a set of new algorithms for the design of an optimized SON topology, which minimizes the economic cost while simultaneously meeting bandwidth and delay constraints. A performance comparison among such algorithms is finally carried out. Copyright © 2009 John Wiley & Sons, Ltd.     

Identification of Human Dihydroorotate Dehydrogenase Inhibitor by a Pharmacophore-Based Virtual Screening Study

Human dihydroorotate dehydrogenase (hDHODH) is an enzyme belonging to a flavin mononucleotide (FMN)-dependent family involved in de novo pyrimidine biosynthesis, a key biological pathway for highly proliferating cancer cells and pathogens. In fact, hDHODH proved to be a promising therapeutic target for the treatment of acute myelogenous leukemia, multiple myeloma, and viral and bacterial infections; therefore, the identification of novel hDHODH ligands represents a hot topic in medicinal chemistry. In this work, we reported a virtual screening study for the identification of new promising hDHODH inhibitors. A pharmacophore-based approach combined with a consensus docking analysis and molecular dynamics simulations was applied to screen a large database of commercial compounds. The whole virtual screening protocol allowed for the identification of a novel compound that is endowed with promising inhibitory activity against hDHODH and is structurally different from known ligands. These results validated the reliability of the in silico workflow and provided a valuable starting point for hit-to-lead and future lead optimization studies aimed at the development of new potent hDHODH inhibitors.     

A highly efficient receiver for satellite‐based automatic identification system signal detection

An innovative receiver architecture for the satellite‐based automatic identification system has been recently proposed. In this paper, we describe a few modifications that can be introduced on the algorithms for synchronization and detection, which provide an impressive performance improvement. The receiver architecture has been designed for an on‐board implementation, and a prototype has been implemented by the University of Parma and CGS S.p.A. Compagnia Generale per lo Spazio under the European Space Agency project FENICE (Flexible innovative AIS receiver prototype). A few modifications are also here described that could allow a further performance improvement in case of processing moved to ground‐based stations, based on a priori information there available. Copyright © 2014 John Wiley & Sons, Ltd.     

Exploring the Parallel G-Quadruplex Nucleic Acid World: A Spectroscopic and Computational Investigation on the Binding of the c-myc Oncogene NHE III1 Region by the Phytochemical Polydatin

Trans-polydatin (tPD), the 3-β-D-glucoside of the well-known nutraceutical trans-resveratrol, is a natural polyphenol with documented anti-cancer, anti-inflammatory, cardioprotective, and immunoregulatory effects. Considering the anticancer activity of tPD, in this work, we aimed to explore the binding properties of this natural compound with the G-quadruplex (G4) structure formed by the Pu22 [d(TGAGGGTGGGTAGGGTGGGTAA)] DNA sequence by exploiting CD spectroscopy and molecular docking simulations. Pu22 is a mutated and shorter analog of the G4-forming sequence known as Pu27 located in the promoter of the c-myc oncogene, whose overexpression triggers the metabolic changes responsible for cancer cells transformation. The binding of tPD with the parallel Pu22 G4 was confirmed by CD spectroscopy, which showed significant changes in the CD spectrum of the DNA and a slight thermal stabilization of the G4 structure. To gain a deeper insight into the structural features of the tPD-Pu22 complex, we performed an in silico molecular docking study, which indicated that the interaction of tPD with Pu22 G4 may involve partial end-stacking to the terminal G-quartet and H-bonding interactions between the sugar moiety of the ligand and deoxynucleotides not included in the G-tetrads. Finally, we compared the experimental CD profiles of Pu22 G4 with the corresponding theoretical output obtained using DichroCalc, a web-based server normally used for the prediction of proteins’ CD spectra starting from their “.pdb” file. The results indicated a good agreement between the predicted and the experimental CD spectra in terms of the spectral bands’ profile even if with a slight bathochromic shift in the positive band, suggesting the utility of this predictive tool for G4 DNA CD investigations.     

Gadolinium‐Decorated Silica Microspheres as Redox‐Responsive MRI Probes for Applications in Cell Therapy Follow‐Up

The redox microenvironment within a cell graft can be considered as an indicator to assess whether the graft is metabolically active or hypoxic. We present a redox‐responsive MRI probe based on porous silica microparticles whose surface has been decorated with a Gd‐chelate through a disulphide bridge. Such microparticles are designed to be interspersed with therapeutic cells within a biocompatible hydrogel. The onset of reducing conditions within the hydrogel is paralleled by an increased clearance of Gd, that can be detected by MRI.     

A simple,efficient, regioselective and one-pot preparation of N-hydroxy- and N–O-protected hydroxyindoles via cycloaddition of nitrosoarenes with alkynes. Synthetic scope,applications and novel by-products

The thermal reaction between nitrosoarenes and alkynes under alkylating conditions produces N-alkoxyindoles as the major products in moderate to good yields and excellent regioselectivity. Various electrophiles are used affording different N–O-protected hydroxyindoles in a multi-component fashion. Privileged acetylenic substrates used in reactions with substituted nitrosoarenes are arylalkynes or propiolates. Potentially bioactive compounds and other classes of highly functionalizable indole products were prepared. Reactions between o-carbomethoxy-nitrosoarenes and arylacetylenes provided tricyclic compounds containing an acylaziridine indoline skeleton.