Screening an In-House Isoquinoline Alkaloids Library for New Blockers of Voltage-Gated Na+ Channels Using Voltage Sensor Fluorescent Probes: Hits and Biases

Voltage-gated Na⁺ (Na_V) channels are significant therapeutic targets for the treatment of cardiac and neurological disorders, thus promoting the search for novel Na_V channel ligands. With the objective of discovering new blockers of Na_V channel ligands, we screened an In-House vegetal alkaloid library using fluorescence cell-based assays. We screened 62 isoquinoline alkaloids (IA) for their ability to decrease the FRET signal of voltage sensor probes (VSP), which were induced by the activation of Na_V channels with batrachotoxin (BTX) in GH3b6 cells. This led to the selection of five IA: liriodenine, oxostephanine, thalmiculine, protopine, and bebeerine, inhibiting the BTX-induced VSP signal with micromolar IC₅₀. These five alkaloids were then assayed using the Na⁺ fluorescent probe ANG-2 and the patch-clamp technique. Only oxostephanine and liriodenine were able to inhibit the BTX-induced ANG-2 signal in HEK293-hNa_V1.3 cells. Indeed, liriodenine and oxostephanine decreased the effects of BTX on Na⁺ currents elicited by the hNa_V1.3 channel, suggesting that conformation change induced by BTX binding could induce a bias in fluorescent assays. However, among the five IA selected in the VSP assay, only bebeerine exhibited strong inhibitory effects against Na⁺ currents elicited by the hNav1.2 and hNav1.6 channels, with IC₅₀ values below 10 µM. So far, bebeerine is the first BBIQ to have been reported to block Na_V channels, with promising therapeutical applications.     

Natural Formulations Based on Olea europaea L. Fruit Extract for the Topical Treatment of HSV-1 Infections

In the present study, a hydroxytyrosol-rich Olea europaea L. fruit extract (OFE) was added to three thoroughly green formulations—hydrogel, oleogel, and cream—in order to evaluate their antiviral activity against HSV-1. The extract was characterized by different analytical techniques, i.e., FT-IR, XPS, and TGA. HPLC analyses were carried out to monitor the content and release of hydroxytyrosol in the prepared formulations. The total polyphenol content and antioxidant activity were investigated through Folin–Ciocâlteu’s reagent, DPPH, and ABTS assays. The ability of the three formulations to convey active principles to the skin was evaluated using a Franz cell, showing that the number of permeated polyphenols in the hydrogel (272.1 ± 1.8 GAE/g) was significantly higher than those in the oleogel and cream (174 ± 10 and 179.6 ± 2 GAE/g, respectively), even if a negligible amount of hydroxytyrosol crossed the membrane for all the formulations. The cell viability assay indicated that the OFE and the three formulations were not toxic to cultured Vero cells. The antiviral activity tests highlighted that the OFE had a strong inhibitory effect against HSV-1 with a 50% inhibitory concentration (IC50) at 25 µg/mL, interfering directly with the viral particles. Among the three formulations, the hydrogel exhibited the highest antiviral activity also against the acyclovir-resistant strain.     

The Small Molecule PPARγ Agonist GL516 Induces Feeding-Stimulatory Effects in Hypothalamus Cells Hypo-E22 and Isolated Hypothalami

PPARγ agonists are implicated in the regulation of diabetes and metabolic syndrome and have therapeutic potential in brain disorders. PPARγ modulates appetite through its central effects, especially on the hypothalamic arcuate nucleus (ARC). Previous studies demonstrated that the small molecule GL516 is a PPARγ agonist able to reduce oxidative stress and apoptosis with a potential neuroprotective role. Herein, we investigated the effects of GL516, in vitro and ex vivo, on the levels of hypothalamic dopamine (DA) and serotonin (5-HT). The gene expressions of neuropeptide Y, CART, AgRP, and POMC, which play master roles in the neuroendocrine regulation of feeding behavior and energy balance, were also evaluated. HypoE22 cells were treated with H₂O₂ (300 μM) for 2 h e 30’ and with different concentrations of GL516 (1 nM-100 µM). The cell viability was evaluated after 24 and 48 h of culturing using the MTT test. DA and 5-HT levels in the HypoE22 cell supernatants were analyzed through HPLC; an ex vivo study on isolated hypothalamic specimens challenged with scalar concentrations of GL516 (1–100 µM) and with pioglitazone (10 µM) was carried out. The gene expressions of CART, NPY, AgRP, and POMC were also determined by a quantitative real-time PCR. The results obtained showed that GL516 was able to reduce DA and 5-HT turnover; moreover, it was effective in stimulating NPY and AgRP gene expressions with a concomitant reduction in CART and POMC gene expressions. These results highlight the capability of GL516 to modulate neuropeptide pathways deeply involved in appetite control suggesting an orexigenic effect. These findings emphasize the potential use of GL516 as a promising candidate for therapeutical applications in neurodegenerative diseases associated with the reduction in food intake and stimulation of catabolic pathways.     

Matisse: A System-on-Chip Design Methodology Emphasizing Dynamic Memory Management

MATISSE is a design environment intended for developing systems characterized by a tight interaction between control and data-flow behavior, intensive data storage and transfer, and stringent real-time requirements. Matisse bridges the gap from a system specification, using a concurrent object-oriented language, to an optimized embedded single-chip hardware/software implementation. Matisse supports stepwise exploration and refinement of dynamic memory management, memory architecture exploration, and gradual incorporation of timing constraints before going to traditional tools for hardware synthesis, software compilation, and inter-processor communication synthesis. With this approach, specifications of embedded systems can be written in a high-level programming language using data abstraction. Application of MATISSE on telecom protocol processing systems in the ATM area shows significant improvements in area usage and power consumption.     

Ultrastructural Damages to H1N1 Influenza Virus Caused by Vapor Essential Oils

Influenza viruses are transmitted from human to human via airborne droplets and can be transferred through contaminated environmental surfaces. Some works have demonstrated the efficacy of essential oils (EOs) as antimicrobial and antiviral agents, but most of them examined the liquid phases, which are generally toxic for oral applications. In our study, we describe the antiviral activity of Citrus bergamia, Melaleuca alternifolia, Illicium verum and Eucalyptus globulus vapor EOs against influenza virus type A. In the vapor phase, C. bergamia and M. alternifolia strongly reduced viral cytopathic effect without exerting any cytotoxicity. The E. globulus vapor EO reduced viral infection by 78% with no cytotoxicity, while I. verum was not effective. Furthermore, we characterized the EOs and their vapor phase by the head-space gas chromatography–mass spectrometry technique, observing that the major component found in each liquid EO is the same one of the corresponding vapor phases, with the exception of M. alternifolia. To deepen the mechanism of action, the morphological integrity of virus particles was checked by negative staining transmission electron microscopy, showing that they interfere with the lipid bilayer of the viral envelope, leading to the decomposition of membranes. We speculated that the most abundant components of the vapor EOs might directly interfere with influenza virus envelope structures or mask viral structures important for early steps of viral infection.     

Cationic molybdenum oxo alkylidenes stabilized by N-heterocyclic carbenes: from molecular systems to efficient supported metathesis catalysts

Cationic d⁰ group 6 olefin metathesis catalysts have been recently shown to display in most instances superior activity in comparison to their neutral congeners. Furthermore, their catalytic performance is greatly improved upon immobilization on silica. In this context, we have developed the new family of molecular cationic molybdenum oxo alkylidene complexes stabilized by N-heterocyclic carbenes of the general formula [Mo(O)(CHCMe₃)(IMes)(OR)[X⁻]] (IMes = 1,3-dimesitylimidazol-2-ylidene; R = 1,3-dimesityl-C₆H₃, C₆F₅; X⁻ = B(3,5-(CF₃)₂C₆H₃)₄⁻, B(Ar^F)₄, tetrakis(perfluoro-t-butoxy)aluminate (PFTA)). Immobilization of [Mo(O)(CHCMe₃)(IMes)(O-1,3-dimesityl-C₆H₃)⁺B(Ar^F)₄⁻] on silica via surface organometallic chemistry yields an active alkene metathesis catalyst that shows the highest productivity towards terminal olefins amongst all existing molybdenum oxo alkylidene catalysts.

The first cationic molybdenum oxo complexes were synthesized and immobilized on partially dehydroxylated silica. Vastly enhanced catalytic activity for terminal olefins was found compared to their neutral congeners.     

Exploring the Parallel G-Quadruplex Nucleic Acid World: A Spectroscopic and Computational Investigation on the Binding of the c-myc Oncogene NHE III1 Region by the Phytochemical Polydatin

Trans-polydatin (tPD), the 3-β-D-glucoside of the well-known nutraceutical trans-resveratrol, is a natural polyphenol with documented anti-cancer, anti-inflammatory, cardioprotective, and immunoregulatory effects. Considering the anticancer activity of tPD, in this work, we aimed to explore the binding properties of this natural compound with the G-quadruplex (G4) structure formed by the Pu22 [d(TGAGGGTGGGTAGGGTGGGTAA)] DNA sequence by exploiting CD spectroscopy and molecular docking simulations. Pu22 is a mutated and shorter analog of the G4-forming sequence known as Pu27 located in the promoter of the c-myc oncogene, whose overexpression triggers the metabolic changes responsible for cancer cells transformation. The binding of tPD with the parallel Pu22 G4 was confirmed by CD spectroscopy, which showed significant changes in the CD spectrum of the DNA and a slight thermal stabilization of the G4 structure. To gain a deeper insight into the structural features of the tPD-Pu22 complex, we performed an in silico molecular docking study, which indicated that the interaction of tPD with Pu22 G4 may involve partial end-stacking to the terminal G-quartet and H-bonding interactions between the sugar moiety of the ligand and deoxynucleotides not included in the G-tetrads. Finally, we compared the experimental CD profiles of Pu22 G4 with the corresponding theoretical output obtained using DichroCalc, a web-based server normally used for the prediction of proteins’ CD spectra starting from their “.pdb” file. The results indicated a good agreement between the predicted and the experimental CD spectra in terms of the spectral bands’ profile even if with a slight bathochromic shift in the positive band, suggesting the utility of this predictive tool for G4 DNA CD investigations.     

Surface anchoring,polarization fields and memory states in polymer dispersed liquid crystals

We have investigated the formation and development of memory states in polymer dispersed liquid crystals induced by the application of a strong electric field. Both the optical transmittance and polarization field have been followed as functions of time. We have been able to distinguish between the contributions to the memory states arising from the surface anchoring of the liquid crystal at the droplet interface and from the electrical reorientation of the mesogenic molecules. The dependence of both residual transmittance and polarization field on temperature is reported and a simple model is proposed.