Prediction and realisation of high mobility and degenerate p-type conductivity in CaCuP thin films

Phosphides are interesting candidates for hole transport materials and p-type transparent conducting applications, capable of achieving greater valence band dispersion than their oxide counterparts due to the higher lying energy and increased size of the P 3p orbital. After computational identification of the indirect-gap semiconductor CaCuP as a promising candidate, we now report reactive sputter deposition of phase-pure p-type CaCuP thin films. Their intrinsic hole concentration and hole mobility exceed 1 × 10²⁰ cm⁻³ and 35 cm² V⁻¹ s⁻¹ at room temperature, respectively. Transport calculations indicate potential for even higher mobilities. Copper vacancies are identified as the main source of conductivity, displaying markedly different behaviour compared to typical p-type transparent conductors, leading to improved electronic properties. The optical transparency of CaCuP films is lower than expected from first principles calculations of phonon-mediated indirect transitions. This discrepancy could be partly attributed to crystalline imperfections within the films, increasing the strength of indirect transitions. We determine the transparent conductor figure of merit of CaCuP films as a function of composition, revealing links between stoichiometry, crystalline quality, and opto-electronic properties. These findings provide a promising initial assessment of the viability of CaCuP as a p-type transparent contact.

We synthesize air-stable, p-type CaCuP thin films with high hole concentration and high hole mobility as potential p-type transparent conductors. We study their optoelectronic properties in detail by advanced experimental and computational methods.     

Shear-induced particle segregation in binary mixtures:Verification of a percolation theory

Granular materials composed of different-sized grains may experience undesired segregation.Segrega-tion is detrimental for a lot of industries because it leads ...     

Thiosemicarbazide-Substituted Coumarins as Selective Inhibitors of the Tumor Associated Human Carbonic Anhydrases IX and XII

A novel series of thiosemicarbazide-substituted coumarins was synthesized and the inhibitory effects against four physiologically relevant carbonic anhydrase isoforms I, II, IX and XII showed selective activities on the tumor-associated IX and XII isozymes. Molecular modeling studies on selected compounds 14a and 22a were performed. The binding modes of such compounds were determined assuming their enzymatically active structures (i.e., cinnamic acid) in the thermodynamically favored, and not previously explored, E geometry. Molecular modelling suggests multiple interactions within the enzymatic cavity and may explain the high potency and selectivity reported for the hCAs IX and XII.     

Metabolic and Proteomic Analysis of Chlorella sorokiniana,Chloroidium saccharofilum,and Chlorella vulgaris Cells Cultured in Autotrophic,Photoheterotrophic, and Mixotrophic Cultivation Modes

Chlorella is one of the most well-known microalgal genera, currently comprising approximately a hundred species of single-celled green algae according to the AlgaeBase. Strains of the genus Chlorella have the ability to metabolize both inorganic and organic carbon sources in various trophic modes and synthesize valuable metabolites that are widely used in many industries. The aim of this work was to investigate the impact of three trophic modes on the growth parameters, productivities of individual cell components, and biochemical composition of Chlorella sorokiniana, Chloroidium saccharofilum, and Chlorella vulgaris cells with special consideration of protein profiles detected by SDS-PAGE gel electrophoresis and two-dimensional gel electrophoresis with MALDI-TOF/TOF MS. Mixotrophic conditions with the use of an agro-industrial by-product stimulated the growth of all Chlorella species, which was confirmed by the highest specific growth rates and the shortest biomass doubling times. The mixotrophic cultivation of all Chlorella species yielded a high amount of protein-rich biomass with reduced contents of chlorophyll a, chlorophyll b, carotenoids, and carbohydrates. Additionally, this work provides the first information about the proteome of Chloroidium saccharofilum, Chlorella sorokiniana, and Chlorella vulgaris cells cultured in molasses supplementation conditions. The proteomic analysis of the three Chlorella species growing photoheterotrophically and mixotrophically showed increased accumulation of proteins involved in the cell energy metabolism and carbon uptake, photosynthesis process, and protein synthesis, as well as proteins involved in intracellular movements and chaperone proteins.     

Neuroprotective Effect of Caffeine in Alzheimer’s Disease

Alzheimer’s disease (AD) is the leading cause of dementia, predicted to be the most significant health burden of the 21st century, with an estimated 131.5 million dementia patients by the year 2050. This review aims to provide an overview of the effect of caffeine on AD and cognition by summarizing relevant research conducted on this topic. We searched the Web of Science core collection and PubMed for studies related to the effect of caffeine on AD and cognition using title search terms: caffeine; coffee; Alzheimer’s; cognition. There is suggestive evidence from clinical studies that caffeine is neuroprotective against dementia and possibly AD (20 out of 30 studies support this), but further studies, such as the “ideal” study proposed in this review, are required to prove this link. Clinical studies also indicate that caffeine is a cognitive normalizer and not a cognitive enhancer. Furthermore, clinical studies suggest the neuroprotective effect of caffeine might be confounded by gender. There is robust evidence based on in vivo and in vitro studies that caffeine has neuroprotective properties in AD animal models (21 out of 22 studies support this), but further studies are needed to identify the mechanistic pathways mediating these effects.     

Exploring the Parallel G-Quadruplex Nucleic Acid World: A Spectroscopic and Computational Investigation on the Binding of the c-myc Oncogene NHE III1 Region by the Phytochemical Polydatin

Trans-polydatin (tPD), the 3-β-D-glucoside of the well-known nutraceutical trans-resveratrol, is a natural polyphenol with documented anti-cancer, anti-inflammatory, cardioprotective, and immunoregulatory effects. Considering the anticancer activity of tPD, in this work, we aimed to explore the binding properties of this natural compound with the G-quadruplex (G4) structure formed by the Pu22 [d(TGAGGGTGGGTAGGGTGGGTAA)] DNA sequence by exploiting CD spectroscopy and molecular docking simulations. Pu22 is a mutated and shorter analog of the G4-forming sequence known as Pu27 located in the promoter of the c-myc oncogene, whose overexpression triggers the metabolic changes responsible for cancer cells transformation. The binding of tPD with the parallel Pu22 G4 was confirmed by CD spectroscopy, which showed significant changes in the CD spectrum of the DNA and a slight thermal stabilization of the G4 structure. To gain a deeper insight into the structural features of the tPD-Pu22 complex, we performed an in silico molecular docking study, which indicated that the interaction of tPD with Pu22 G4 may involve partial end-stacking to the terminal G-quartet and H-bonding interactions between the sugar moiety of the ligand and deoxynucleotides not included in the G-tetrads. Finally, we compared the experimental CD profiles of Pu22 G4 with the corresponding theoretical output obtained using DichroCalc, a web-based server normally used for the prediction of proteins’ CD spectra starting from their “.pdb” file. The results indicated a good agreement between the predicted and the experimental CD spectra in terms of the spectral bands’ profile even if with a slight bathochromic shift in the positive band, suggesting the utility of this predictive tool for G4 DNA CD investigations.     

Preparation and Photocatalytic Performance of TiO2 Nanowire-Based Self-Supported Hybrid Membranes

Nowadays, the use of hybrid structures and multi-component materials is gaining ground in the fields of environmental protection, water treatment and removal of organic pollutants. This study describes promising, cheap and photoactive self-supported hybrid membranes as a possible solution for wastewater treatment applications. In the course of this research work, the photocatalytic performance of titania nanowire (TiO₂ NW)-based hybrid membranes in the adsorption and degradation of methylene blue (MB) under UV irradiation was investigated. Characterization techniques such as scanning electron microscopy (SEM), transmission electron microscopy (TEM), energy-dispersive X-ray spectroscopy (EDS), X-ray powder diffractometry (XRD) were used to study the morphology and surface of the as-prepared hybrid membranes. We tested the photocatalytic efficiency of the as-prepared membranes in decomposing methylene blue (MB) under UV light irradiation. The hybrid membranes achieved the removal of MB with a degradation efficiency of 90% in 60 min. The high efficiency can be attributed to the presence of binary components in the membrane that enhanced both the adsorption capability and the photocatalytic ability of the membranes. The results obtained suggest that multicomponent hybrid membranes could be promising candidates for future photocatalysis-based water treatment technologies that also take into account the principles of circular economy.     

DSC study of stabilizing effect of antioxidant mixtures in styrene-butadiene rubber

The type of cooperation between antioxidants in the binary mixtures of four substituted diphenylamines and phenotiazine in the stabilization of styrene-butadiene rubber has been tested. Thermooxidation of the samples has been studied by differential scanning calorimetry under non-isothermal conditions. The protection factors of the individual stabilizers and their mixtures were determined. The synergy factors were applied to asses the type of cooperation of antioxidants in the mixtures. From their values it can be concluded that the type of cooperation depends on temperature. The highest synergistic effect has been observed for the mixture of phenotiazine and [4-(1-methyl-1-phenyl-ethyl)-phenyl]-phenylamine.     

Reduced Impact of Induced Gate Noise on Inductively Degenerated LNAs in Deep Submicron CMOS Technologies

Designers of radio-frequency inductively-degenerated CMOS low-noise-amplifiers have usually not followed the guidelines for achieving minimum noise figure. Nonetheless, state-of-the-art implementations display noise figure values very close to the theoretical minimum. In this paper, we point out that this is due to the effect of the parasitic overlap capacitances in the MOS device. In particular, we show that overlap capacitances lead to a significant induced-gate-noise reduction, especially when deep sub-micron CMOS processes are used.Paolo Rossi was born in Milan, Italy, in 1975. He received the Laurea degree (summa cum laude) in electrical engineering from the University of Pavia, Pavia, Italy, in 2000, where he is currently working toward the Ph.D. degree. His research interests are in the field of analog integrated circuits for wireless transceivers in CMOS and BiCMOS technology, with particular focus on the analysis and design of LNA and mixer for multi-standard applications.Francesco Svelto received the Laurea and Ph.D. degrees in electrical engineering from the University of Pavia, Pavia, Italy, in 1991 and 1995, respectively. From 1996 to 1997, he held a grant from STMicroelectronics to design CMOS RF circuits. In 1997, he was appointed Assistant Professor at the University of Bergamo, Italy, and in 2000, he joined the University of Pavia, where he is an Associate Professor. His current research interests are in the field of RF design and high-frequency integrated circuits for telecommunications. Dr. Svelto has been a member of the technical program committee of the IEEE Custom Integrated Circuits Conference since 2000 and the Bipolar/BiCMOS Circuits and Technology Meeting (BCTM) since 2003, and the European Solid State Circuits Conference in 2002. He served as Guest Editor of the March 2003 special issue of the IEEE Journal of Solid-State Circuits, of which he is currently an Associate Editor.Andrea Mazzanti was born in Modena (Italy) in 1976. He received the Laurea degree (summa cum Laude) in Electrical Engineering from the University of Modena and Reggio Emilia, Modena, Italy in 2001. Since 2001 he is pursuing his PhD in Electrical Engineering at University of Modena and Reggio Emilia, Italy. His major research interest are modelling of microwave semiconductor devices and design of CMOS RF integrated circuits, with particular focus on low noise oscillators and analog frequency dividers. During the summer of 2003 he was with Agere Systems, Allentown, PA as an internship student, working on the design of an highly integrated CMOS FM transmitter.Pietro Andreani received the M.S.E.E. from the University of Pisa, Italy, in 1988. He joined the Dept. of Applied Electronics, Lund University, Sweden, in 1990, where he contributed to the development of software tools for digital ASIC design. After working at the Dept. of Applied Electronics, University of Pisa, as a CMOS IC designer during 1994, he rejoined the Dept. of Applied Electronics in Lund as an Associate Professor, where he was responsible for the analog IC course package between 1995 and 2001, and where he received the Ph.D. degree in 1999. He is currently a Professor at the Center for Physical Electronics, ØrstedDTU, Technical University of Denmark, Kgs. Lyngby, Denmark, with analog/RF CMOS IC design as main research field.