Crystallization Mechanism of 9,9-Diphenyl-dibenzosilole from Solids

Organic semiconductor (OSC) crystals have great potential to be applied in many fields, as they can be flexibly designed according to the demands and show an outstanding device performance. However, OSCs with the capacity of solid-state crystallization (SSC) are developing too slowly to meet demands in productions and applications, due to their difficulties in molecular design and synthesis, unclear mechanism and high dependence on experimental conditions. In this work, in order to solve the problems, we synthesized an organic semiconductor capable of SSC at room temperature by adjusting the relationship between conjugated groups and functional groups. The thermodynamic and kinetic properties have been studied to discover the model of film SSC. Moreover, it can be purposefully controlled to prepare the high-quality crystals, and their corresponding organic electronic devices were further fabricated and discussed.     

Two-dimensional tellurium saturable absorber for ultrafast solid-state laser

Two-dimensional(2 D) Te nanosheets were successfully fabricated through the liquid-phase exfoliation(LPE) method. The nonlinear optical properties of 2 D Te nanosheets were studied by the open-aperture Z-scan technique. Furthermore, the continuous wave mode-locked Nd:YVO_4 laser was successfully realized by using 2 D Te as a saturable absorber(SA) for the first time, to the best of our knowledge. Ultrashort pulses as short as 5.8 ps were obtained at 1064.3 nm with an output power of 851 m W. This primary investigation indicates that the 2 D Te SA is a promising photonic device in the fields of ultrafast solid-state lasers.     

Chain transfer and living functionalization of polymethacrylates by group transfer polymerization using ethyl 2-Phenyl-2-butenoate

A living functionalization method has been investigated for group transfer polymerization (GTP) of poly(alkyl methacrylates) using ethyl 2-phenyl-2-butenoate (EPB). The end-capping reactions of EPB to living trimethylsilyl ketene acetal-ended poly(methyl methacrylate) (PMMA) chain ends have been systematically studied and characterized by SEC, VPO, UV-visible spectrosocopy, ¹H and ¹³c NMR spectroscopy. The results of sequential monomer addition, varying stoichiometry and copolymerization indicate that EPB effects efficient chain end functionalization only at stoichiometric concentrations; chain transfer reactions (chain transfer constant = 0.4) occur with excess EPB and during copolymerization with MMA. Chain transfer reactions (chain transfer constant = 0.1) also occur when copolymerizing ethyl 2-methyl-2-butenoate with MMA.     

Meshfree simulations of large scale ductile fracture of stiffened ship hull plates during ship stranding

Meccanica - In this work, we have developed a systematic computational methodology to directly simulate the ductile fracture of ship hull structure during ship stranding based on the meshfree...     

Establishment of the tension stress model considering metal lateral flow for foil rolling

In rolling production, the foil flatness quality is judged by detecting the lateral distribution of the front tension stress. Currently, because of the inaccuracy of the tension control model, there are still many flatness defects in foil rolling production. For the tension stress model of foil rolling, the primary problem is the inaccuracy of the metal lateral flow model. Therefore, based on Fleck’s foil rolling theory, a new model of the lateral displacement in the foil deformation region is established by using the principle of minimum potential energy. Next, a tension stress model is established, which takes the effect of the metal lateral flow into account. Last, using a laboratory 20-high rolling mill as the research object, the finite element model of foil rolling is established, and the accuracy of the new model is demonstrated by comparing the theoretical calculations with the simulation results.

     

Development of a Genus-Universal Nucleotide Signature for the Identification and Supervision of Ephedra-Containing Products

Ephedra plants generally contain ephedrine alkaloids, which are the critical precursor compounds of methamphetamine (METH). METH could cause serious physical and mental damage, and therefore Ephedra materials are strictly in supervision internationally. However, unlawful utilization of Ephedra herbs and its products still exist. Thus, it is imperative to establish a universal method for monitoring Ephedra ingredients in complex mixtures and processed products. In this study, 224 ITS2 sequences representing 59 taxa within Ephedra were collected, and a 23-bp genus-level nucleotide signature (GTCCGGTCCGCCTCGGCGGTGCG) was developed for the identification of the whole genus. The specific primers MH-1F/1R were designed, and 125 individuals of twelve Ephedra species/varieties were gathered for applicability verification of the nucleotide signature. Additionally, seven batches of Chinese patent medicines containing Ephedra herbs were used to test the application of the nucleotide signature in complex and highly processed materials. The results demonstrated that the 23-bp molecular marker was unique to Ephedra and conserved within the genus. It can be successfully utilized for the detection of Ephedra components in complex preparations and processed products with severe DNA degradation. The method developed in this study could undoubtedly serve as a strong support for the supervision of illegal circulation of Ephedra-containing products.     

Molecular Weight Distribution Control for Polymerization Processes Based on the Moment-Generating Function

The molecular weight distribution is an important factor that affects the properties of polymers. A control algorithm based on the moment-generating function was proposed to regulate the molecular weight distribution for polymerization processes in this work. The B-spline model was used to approximate the molecular weight distribution, and the weight state space equation of the system was identified by the subspace state space system identification method based on the paired date of B-spline weights and control inputs. Then, a new performance criterion mainly consisting of the moment-generating function was constructed to obtain the optimal control input. The effectiveness of the proposed control method was tested in a styrene polymerization process. The molecular weight distribution of the styrene polymers can be approximated by the B-spline model effectively, and it can also be regulated towards the desired one under the proposed control method.     

Side-by-side comparison of disposable microchips with commercial capillary cartridges for application in capillary isoelectric focusing with whole column imaging detection

Simple-structured, well-functioned disposable poly(dimethylsiloxane) (PDMS) microchips were developed for capillary isoelectric focusing with whole column imaging detection (CIEF-WCID). Side-by-side comparison of the developed microchips with well-established commercial capillary cartridges demonstrated that the disposable microchips have comparable performance as well as advantages such as absence of lens effect and possibility of high-aspect-ratio accompanied with a dramatic reduction in cost.     

Crystal structures and thermal decomposition kinetics of lanthanide complexes with 3,4,5-trimethoxybenzoic acid and 1,10-phenanthroline

A series of lanthanide complexes with the 3,4,5-trimethoxybenzoic acid(3,4,5-tmoba) and 1,10-phenanthroline(phen),[Ln(3,4,5-tmoba) 3 phen] 2(Ln = Pr(1),Nd(2) and Ho(3)),have been synthesized and characterized by a series of techniques including elemental analysis,IR spectra,X-ray crystallography and TG/DSC-FTIR technology.The three complexes have two kinds of coordination modes,in which the Pr 3+ and Nd 3+ cations are nine-coordinated and the Ho 3+ cation is eight-coordinated.The three-dimensional IR accumulation spectra of gaseous products for complexes 1-3 were analyzed and the gaseous products were identified by the typical IR spectra obtained from the 3D surface graphs.Meanwhile,we obtained the activation energy E of the first steps of complexes 1-3 by the integral isoconversional non-linear(NL-INT) method and discussed the non-isothermal kinetics of complexes 1-3 using the Malek method.Finally,SB(m,n) was defined as the kinetic method of the first-step thermal decomposition.The thermodynamic parameters △G≠,△H≠ and △S≠ of activation at the peak temperature were also calculated.     

Anthraquinones from the Aerial Parts of Rubia cordifolia with Their NO Inhibitory and Antibacterial Activities

The present study aimed to identify the composition of the aerial parts of Rubia cordifolia L. A chemical investigation on the EtOAc extracts from the aerial parts of Rubia cordifolia resulted in the isolation of four new anthraquinones, namely Cordifoquinone A–D (1–4), along with 16 known anthraquinones. Their structures were elucidated on the basis of NMR and HR-ESIMS data. All isolates were assessed for their inhibitory effects on NO production in LPS-stimulated RAW 264.7 macrophage cells. Compounds 1, 3 and 10 exhibited significant inhibitory activities with IC₅₀ values of 14.05, 23.48 and 29.23 μmol·L⁻¹, respectively. Their antibacterial activities of four bacteria, Escherichia coli (ATCC 25922), Staphylococcus aureus subsp. aureus (ATCC 29213), Salmonella enterica subsp. enterica (ATCC 14028) and Pseudomonas aeruginosa (ATCC 27853), were also evaluated. Our results indicated that the antibacterial activity of these compounds is inactive.