Origin of high second- and third-order nonlinear optical response in ammonio/borato diphenylpolyene zwitterions: the remarkable role of polarized aromatic groups

We present a quantum-chemical analysis of the molecular structure and second- and third-order polarizabilities in a series of promising nonlinear optical (NLO) chromophores, the zwitterionic ammonio/borato diphenylpolyenes, R3N+Ph(C=C)nPhB-R3, whose synthesis has been reported recently. The molecular geometries are obtained via MP2/6-31G optimization, while the NLO properties are calculated with the INDO Hamiltonian using the sum-over-states and finite-field real-space methods. The real-space approach allows the direct evaluation of the NLO-active segments of the molecules, while the sum-over-states results illustrate the virtual excitations and charge-transfer pathways that are essential in the NLO response. Both methods highlight the remarkable and unexpected result that it is the strongly polarized phenylene groups that play the key role in generating a high NLO response.     

Synthesis and anion binding properties of 2,5-diamidothiophene polypyrrole Schiff base macrocycles

[reaction: see text] Two easy-to-synthesize polypyrrolic 2,5-diamidothiophene Schiff base macrocycles are reported, along with their anion binding properties as determined via UV-vis spectroscopic titrations carried out in dichloroethane. There is a striking difference between the interactions with anions of the two macrocycles, a finding ascribed to differences in their rigidity. For example, the more flexible dipyrromethane-derived macrocycle displays a 1.2:1 hydrogen sulfate versus nitrate selectivity, while its more rigid bipyrrole-derived congener shows a 7.4:1 selectivity in favor to hydrogen sulfate.     

Oriented immobilization of Desulfovibrio gigas hydrogenase onto carbon electrodes by covalent bonds for nonmediated oxidation of H2

The orientation of hydrogenase bound covalently to a pyrolytic graphite edge electrode modified with a 4-aminophenyl monolayer can be modulated via electrostatic interactions during the immobilization step. At low ionic strength and when the amino groups of the electrode surface are mostly protonated, the hydrogenase is immobilized with the negatively charged region that surrounds its 4Fe4S cluster nearer to the protein surface facing the electrode. This allows direct electron transfer between the immobilized hydrogenase and the electrode, which is observed by the strong catalytic currents measured in the presence of the H2 substrate. Therefore, a very stable enzymatic electrode is produced that catalyzes nonmediated H2 oxidation.     

2,2,5,5-tetramethylpyrrolidin-3-one-1-sulfinyl group for 5'-hydroxyl protection of deoxyribonucleoside phosphoramidites in the solid-phase preparation of DNA oligonucleotides

Several nitrogen-sulfur reagents have been investigated as potential 5'-hydroxyl protecting groups for deoxyribonucleoside phosphoramidites to improve the synthesis of oligonucleotides on glass microarrays. Out of the nitrogen-sulfur-based protecting groups so far investigated, the 2,2,5,5-tetramethylpyrrolidin-3-one-1-sulfinyl group exhibited near optimal properties for 5'-hydroxyl protection by virtue of the mildness of its deprotection conditions. Specifically, the iterative cleavage of a terminal 5'-sulfamidite group in the synthesis of 5'-d(ATCCGTAGCCAAGGTCATGT) on controlled-pore glass is efficiently accomplished by treatment with iodine in the presence of an acidic salt. Hydrolysis of the oligonucleotide to its 2'-deoxyribonucleosides upon exposure to snake venom phosphodiesterase and bacterial alkaline phosphatase did not reveal the formation of any nucleobase adducts or other modifications. These findings indicate that the 2,2,5,5-tetramethylpyrrolidin-3-one-1-sulfinyl group for 5'-hydroxyl protection of phosphoramidites, such as 10a-d, may lead to the production of oligonucleotide microarrays exhibiting enhanced specificity and sensitivity in the detection of nucleic acid targets.     

Flexible ureasil hybrids with tailored optical properties through doping with metal nanoparticles

Hybrid organic-inorganic nanocomposites containing uniform distributions of metal nanoparticles have been prepared by mixing a preformed nanoparticle colloid with the precursors of a ureasil, prior to the sol-gel transition. These nanocomposites possess not only high optical quality and optical features dictated by the size and shape of the nanoparticle dopants but also a high degree of flexibility, which can largely enhance the range of applications in practical devices. The deposition of a uniform silica shell on the nanoparticle surface prior to the sol-gel transition was found to be required to maintain the colloidal stability during the process and, thus, to retain the optical properties in the final nanocomposite material. This method can be readily extended to other materials, such as semiconductor and magnetic nanoparticles.     

Stereoselective synthesis of individual isomers of Leu-enkephalin analogues containing substituted beta-turn bicyclic dipeptide mimetics

Novel constrained beta-turn dipeptide mimetics, 8-phenyl thiaindolizidinone amino acids 3, have been synthesized stereoselectively and incorporated into Leu-enkephalin peptides as a replacement of dipeptide Gly3-Phe4 to afford four individual isomers of Leu-enkephalin analogues 6.     

Gemini-induced columnar jointing in vitreous ice. Cryo-HRSEM as a tool for discovering new colloidal morphologies

A gemini surfactant is able to promote columnar jointing in vitreous ice where long pillars, often of hexagonal cross section, are formed. This jointing is visible by cryo-high-resolution scanning electron microscopy (cryo-HRSEM), in which colloidal suspensions in bulk water are cooled rapidly in liquid ethane, thereby avoiding the potential artifacts with other types of EM. The jointing is proposed to arise from a new type of colloidal morphology where the surfactant self-assembles into hexagonal columns. Evidence for this mechanism comes from a cryo-HRSEM photo of an ice-free hexagonal "skeleton" composed of surfactant. Cryo-HRSEM, a method that is just beginning to realize its potential, would seem to have a promising future in the discovery of additional and as yet unimagined colloidal structures.     

In situ Fourier transform infrared spectroscopy as an efficient tool for determination of reaction kinetics

The performance of new FTIR-based monitoring technology to representatively determine reaction kinetics has been demonstrated on an example of homogeneously catalyzed liquid-phase sucrose hydrolysis to fructose and glucose. The reaction kinetics were investigated by using the ReactIR 1000 reaction analysis system, which enables determination of the component concentration from its characteristic FTIR spectrum. During the sucrose inversion, the ReactIR 1000 instrument connected to a computer controlled standard glass batch reactor provided the required operating conditions and information about the component concentration in real-time. We have studied the influence of hydrogen ion concentration, temperature and initial concentration of sucrose on the sucrose disappearance rate. It was found out that the inversion of sucrose is an irreversible reaction, which is not affected by the formation of fructose and glucose in the liquid-phase. Then, the parameters of the kinetic model (i.e., reaction rate constant and activation energy) were calculated. A comparison of the model output and the measured data showed that the kinetics of the sucrose inversion could be well described by means of the pseudo first-order kinetic model. Finally, the method of determining the kinetic model by FTIR spectroscopy was verified by comparing the results obtained in the batch reactor with the results obtained in the continuously stirred tank reactor.     

THE EFFECTS OF THROMBOXANE INHIBITORS ON THE MICROVASCULAR AND TUMOR RESPONSE TO PHOTODYNAMIC THERAPY

Abstract— Vascular stasis and tissue ischemia are known to cause tumor cell death in several experimental models after photodynamic therapy (PDT); however, the mechanisms leading to this damage remain unclear. Because previous studies indicated that thromboxane release is implicated in vessel damage, we further examined the role of throm-boxane in PDT. Rats bearing chondrosarcoma were injected with 25 mg/kg Photofrin® (intravenously) 24 h before treatment. Light (135 J/cm ² , 630 nm) was delivered to thc tumor area after injection of one of the following inhibitors: (1) R68070: a thromboxane synthetase inhibitor; (2) SQ-29548: a thromboxane receptor antagonist; and (3) Flunarizine: an inhibitor of platelet shape change. Systemic thromboxane levels were determined. Vessel constriction and leakage were evaluated by intravital microscopy. Tumor response was assessed after treatment. Thromboxane levels were decreased more than 50% with SQ-29548 as compared to controls. Thromboxane levels in animals given R68070 and Flunarizine remained at baseline levels. SQ-29548 and R68070 reduced vessel constriction compared to controls, while Flunarizine totally prevented vessel constriction. R68070 and SQ-29548 inhibited vessel permeability compared to PDT controls; Flunarizine did not. Animals given these inhibitors showed markedly reduced tumor cure. These results indicate that the release of thromboxane is linked to the vascular response in PDT.