Kac-Moody group representations and generalization of the Sugawara construction of the Virasoro algebra

We discuss the dynamical structure of the semidirect product of the Virasoro and affine Kac-Moody groups within the framework of a group quantization formalism. This formalism provides a realization of the Virasoro algebra acting on Kac-Moody Fock states which generalizes the Sugawara construction. We also give an explicit construction of the standard Kac-Moody group representations associated with strings on SU(2) and recover, in particular, the renormalization factor of L(z) Research partially supported by the Conselleria de Cultura de la Generalitat Valenciana, the Plan de Formacion del Personal Investigador, the Comision Asesora de Investigacion Cientifica y Tecnica (CAICYT), and The British Council.     

Magnetized cosmological model

The object of this paper is to investigate the behavior of the magnetic field in a cosmological model for perfect fluid distribution. The magnetic field is due to an electric current produced along thex axis. It is assumed that expansion () in the model is proportional to ₁ ¹ , the eigenvalue of the shear tensor _i ^j . The behavior of the model when the magnetic field tends to zero and other physical properties are also discussed.     

Oriented immobilization of Desulfovibrio gigas hydrogenase onto carbon electrodes by covalent bonds for nonmediated oxidation of H2

The orientation of hydrogenase bound covalently to a pyrolytic graphite edge electrode modified with a 4-aminophenyl monolayer can be modulated via electrostatic interactions during the immobilization step. At low ionic strength and when the amino groups of the electrode surface are mostly protonated, the hydrogenase is immobilized with the negatively charged region that surrounds its 4Fe4S cluster nearer to the protein surface facing the electrode. This allows direct electron transfer between the immobilized hydrogenase and the electrode, which is observed by the strong catalytic currents measured in the presence of the H2 substrate. Therefore, a very stable enzymatic electrode is produced that catalyzes nonmediated H2 oxidation.     

2,2,5,5-tetramethylpyrrolidin-3-one-1-sulfinyl group for 5'-hydroxyl protection of deoxyribonucleoside phosphoramidites in the solid-phase preparation of DNA oligonucleotides

Several nitrogen-sulfur reagents have been investigated as potential 5'-hydroxyl protecting groups for deoxyribonucleoside phosphoramidites to improve the synthesis of oligonucleotides on glass microarrays. Out of the nitrogen-sulfur-based protecting groups so far investigated, the 2,2,5,5-tetramethylpyrrolidin-3-one-1-sulfinyl group exhibited near optimal properties for 5'-hydroxyl protection by virtue of the mildness of its deprotection conditions. Specifically, the iterative cleavage of a terminal 5'-sulfamidite group in the synthesis of 5'-d(ATCCGTAGCCAAGGTCATGT) on controlled-pore glass is efficiently accomplished by treatment with iodine in the presence of an acidic salt. Hydrolysis of the oligonucleotide to its 2'-deoxyribonucleosides upon exposure to snake venom phosphodiesterase and bacterial alkaline phosphatase did not reveal the formation of any nucleobase adducts or other modifications. These findings indicate that the 2,2,5,5-tetramethylpyrrolidin-3-one-1-sulfinyl group for 5'-hydroxyl protection of phosphoramidites, such as 10a-d, may lead to the production of oligonucleotide microarrays exhibiting enhanced specificity and sensitivity in the detection of nucleic acid targets.     

Acrylamide analysis: assessment of results from six rounds of Food Analysis Performance Assessment Scheme (FAPAS) proficiency testing

Six proficiency tests have now been completed in an ongoing program of the UK Food Analysis Performance Assessment Scheme (FAPAS) for the analysis of acrylamide in a range of food matrixes. Homogeneous test material samples were requested by laboratories throughout the world, with 29 to 45 submitting results for each test. Results were analyzed by appropriate statistical procedures, and z-scores were awarded for reported values. In the absence of both legislation and collaborative trial data, the target standard deviation was derived from the Horwitz equation, although it is acknowledged that there is a need to establish a "fit for purpose" target standard deviation specifically for acrylamide analysis. Participants were encouraged to use the analytical method routinely used in their own laboratory and to provide details of their procedure. Close examination of the data submitted indicates that performance is generally acceptable in terms of accuracy. There is no significant difference between results submitted by gas chromatography and liquid chromatography (GC and LC) methods, and no method dependency on the use of internal standards or sample size. However, choice of extraction solvent may be important, with indications that plain water is an acceptable extraction method. There is evidence from the most recent test that direct (underivatized) GC methodology may present problems, but more data are required and this aspect will be monitored in the continuing proficiency testing program.     

Gemini-induced columnar jointing in vitreous ice. Cryo-HRSEM as a tool for discovering new colloidal morphologies

A gemini surfactant is able to promote columnar jointing in vitreous ice where long pillars, often of hexagonal cross section, are formed. This jointing is visible by cryo-high-resolution scanning electron microscopy (cryo-HRSEM), in which colloidal suspensions in bulk water are cooled rapidly in liquid ethane, thereby avoiding the potential artifacts with other types of EM. The jointing is proposed to arise from a new type of colloidal morphology where the surfactant self-assembles into hexagonal columns. Evidence for this mechanism comes from a cryo-HRSEM photo of an ice-free hexagonal "skeleton" composed of surfactant. Cryo-HRSEM, a method that is just beginning to realize its potential, would seem to have a promising future in the discovery of additional and as yet unimagined colloidal structures.     

Thermal conductivity measurements on ferrofluids

The thermal conductivity of a number of ferrofluids consisting of colloidally dispersed Fe₃O₄ particles in diester, hydrocarbon, water and fluorcarbon carriers have been measured at 38°C. The variation in thermal conductivity with particle concentration is well described by Tareef's equation (1940). This has enabled the ratio of the physical to magnetic size to be determined and compared with estimates of the ratio obtained from electron micrographs and magnetic measurements.The fit between theory and experiment is particularly good for hydrocarbon carrier fluids giving the ratio of solid to magnetic radiusR _i/R _m=1.24±0.03 compared with the value obtained from magnetic data and electron micrographs of 1.19±0.07. The corresponding value from the fluids with a diester carrier ranges between 1.1<R _d/R _m<1.3 which is again consistent with microscopy and magnetic data.The application of a magnetic field of 0.1 T had no noticeable effect on the thermal conductivities of ferrofluids.     

Transport properties of alkyltrimethylammonium bromide surfactants in aqueous solutions

Differential mutual diffusion coefficients of n-alkyltrimethylammonium bromides [CH₃(CH₂)_n–1N(CH₃)₃Br, C_nTAB] (n=10, 12, 14, 16) have been measured in aqueous solutions at 298.15 K using a conductimetric cell and an automatic apparatus to follow diffusion. The cell is based on an open-ended capillary, and the technique follows the diffusion process by measuring the resistance of a solution inside the capillaries at various times. The electrical conductances of those solutions have also been measured to calculate the critical micellar concentration (cmc). Thermodynamic analysis of the data suggests that the free ion concentration decreases at concentrations above the cmc, in agreement with theoretical predictions. The obtained values of the micellization parameters were used to model the mutual diffusion coefficients of C_nTAB aqueous solutions.     

Detection of metal ions using ion-channel sensor based on self-assembled monolayer of thioctic acid

Gold electrodes were chemically modified with thioctic acid monolayer designed to mimic biological ion-channel membranes. The technique was then used in the determination of alkali, alkaline earth, thallium(I), and lanthanum metal cations as analytes. Cyclic voltammograms (CV) of [Fe(CN)6]³⁻ an electroactive marker, were measured in the presence of the various types of analyte cations. In the absence of the analyte cation, electrostatic repulsion between the marker anions and the carboxylate groups of the receptor monolayer hindered the approach of the marker anion to the electrode surface and hence hindered its reduction. The modified electrodes responded well to the metal cations except the alkali metal cations. The sensors could detect the trivalent cation La³⁺ at concentrations as low as 10⁻⁸ M. The response of the sensor to the metal cations increase in the order alkali metal3+ can be discriminated in the ratio 1:100. This makes it possible to determine the trivalent ion in a sample matrix containing monovalent and divalent cations. Thallium(I) ion showed marked deviation in its response as compared to monovalent ions of the alkali metals. The ion-channel sensor based on self-assembled monolayer of thioctic acid therefore offers a potential alternative technique for the selective determination of metal ions.