Investigation of a stereoselective co-mediated rearrangement reaction

A stereocontrolled approach to alpha-alkyl beta-alkynyl cyclohexanones is reported through a Lewis acid mediated rearrangement reaction of enol ethers bearing an Co-alkyne moiety. The reaction proceeds with high levels of stereoselectivity in the presence of Ti- and B-Lewis acids to provide a range of alpha,beta-disubstituted cyclohexanones in high yield although the products are prone to epimerization at the alpha-position in the presence of the B-promoter system. The potential for an enantioselective variant of this process is outlined, and a rationale for the observed stereochemical trends and detailed structural analyses of the ketone products are described.     

Investigation of the interaction of carbofuran and DNA by voltammetry and fluorescence with the aid of chemometrics

<正>The interactions of carbofuran and DNA were studied using voltammetry and fluorescence spectroscopy.The formation of carbofuran-DNA makes the current peak of DNA decreased by voltammetry method.The binding number(n) and constant(K_a) for complex carbofuran-DNA were calculated to be 1.06±0.04 and 0.11±0.03mol~(-1) L,respectively by fluorescence measurement.Chemometrics approach,such as singular value decomposition(SVD) was used to evaluate the number of spectral species in the drug-DNA binding process.And the pure spectra and concentration profiles in the kinetic system were clearly deduced by multivariate curve resolution alternating least squares(MCR-ALS) with the initial estimates by evolving factor analysis(EFA).     

Analysis of basic compounds at high pH values by reversed-phase liquid chromatography

Reversed phase high performance liquid chromatography (RPLC) is currently the method of choice for the analysis of basic compounds. However, with traditional silica materials, secondary interactions between the analyte and residual silanols produce peak tailing which can negatively affect resolution, sensitivity, and reproducibility. In order to reduce these secondary interactions, which comprise ion exchange, hydrogen bonding, and London forces interactions, chromatographic analyses can be carried out at low or high pH values where silanol groups and basic compounds are mostly uncharged. The chromatographic behaviour of a particular bidentate stationary phase, Zorbax Extend C18, was studied with a set of basic and neutral compounds. Thanks to a higher chemical stability than traditional silica based supports, analyses were carried out with a high pH mobile phase, which represents a good alternative to the acidic mobile phases generally used to reduce ion exchange interactions. The performance of this bidentate stationary phase was also compared with that of other supports and it was proved that it is advantageous to work with high pH mobile phases when analyzing basic compounds.     

Synthesis, nuclear, and magnetic structures and magnetic properties of [Mn3(OH)2(SO4)2(H2O)2

[Mn(3)(OH)(2)(SO(4))(2)(H(2)O)(2)] and its deuterated analogue were synthesized by a hydrothermal technique and characterized by differential thermal analysis, thermogravimetric analysis, and IR spectroscopy. Its nuclear structure, determined by single-crystal X-ray analysis and Rietveld analysis of neutron powder-diffraction data, consists of a 3D network of chains of edge-sharing Mn(1)O(6), running along the c axis, connected by the apices of Mn(2)O(6) and SO(4) units. It is isostructural to the nickel analogue. Determination of the magnetic structure and measurements of magnetization and heat capacity indicate the coexistence of both magnetic long-range ordering (LRO) and short-range ordering (SRO) below a Néel temperature of 26 K, while the SRO is retained at higher temperatures. The moments of the two independent Mn atoms lie in the bc plane, and that of Mn(1) rotates continuously by 54 degrees towards the c axis on decreasing the temperature from 25 to 1.4 K. While the SRO may be associated with frustration of the moments within a Mn(3) trimer, the LRO is achieved by antiparallel alignment of the four symmetry-related trimers within the magnetic unit cell. A spin-flop field, measured by dc and ac magnetization on a SQUID, is observed at 15 kOe.     

2,2,5,5-tetramethylpyrrolidin-3-one-1-sulfinyl group for 5'-hydroxyl protection of deoxyribonucleoside phosphoramidites in the solid-phase preparation of DNA oligonucleotides

Several nitrogen-sulfur reagents have been investigated as potential 5'-hydroxyl protecting groups for deoxyribonucleoside phosphoramidites to improve the synthesis of oligonucleotides on glass microarrays. Out of the nitrogen-sulfur-based protecting groups so far investigated, the 2,2,5,5-tetramethylpyrrolidin-3-one-1-sulfinyl group exhibited near optimal properties for 5'-hydroxyl protection by virtue of the mildness of its deprotection conditions. Specifically, the iterative cleavage of a terminal 5'-sulfamidite group in the synthesis of 5'-d(ATCCGTAGCCAAGGTCATGT) on controlled-pore glass is efficiently accomplished by treatment with iodine in the presence of an acidic salt. Hydrolysis of the oligonucleotide to its 2'-deoxyribonucleosides upon exposure to snake venom phosphodiesterase and bacterial alkaline phosphatase did not reveal the formation of any nucleobase adducts or other modifications. These findings indicate that the 2,2,5,5-tetramethylpyrrolidin-3-one-1-sulfinyl group for 5'-hydroxyl protection of phosphoramidites, such as 10a-d, may lead to the production of oligonucleotide microarrays exhibiting enhanced specificity and sensitivity in the detection of nucleic acid targets.     

Gelatin methacrylate as a promising hydrogel for 3D microscale organization and proliferation of dielectrophoretically patterned cells

Establishing the 3D microscale organization of cells has numerous practical applications, such as in determining cell fate (e.g., proliferation, migration, differentiation, and apoptosis) and in making functional tissue constructs. One approach to spatially pattern cells is by dielectrophoresis (DEP). DEP has characteristics that are important for cell manipulation, such as high accuracy, speed, scalability, and the ability to handle both adherent and non-adherent cells. However, widespread application of this method is largely restricted because there is a limited number of suitable hydrogels for cell encapsulation. To date, polyethylene glycol-diacrylate (PEG-DA) and agarose have been used extensively for dielectric patterning of cells. In this study, we propose gelatin methacrylate (GelMA) as a promising hydrogel for use in cell dielectropatterning because of its biocompatibility and low viscosity. Compared to PEG hydrogels, GelMA hydrogels showed superior performance when making cell patterns for myoblast (C2C12) and endothelial (HUVEC) cells as well as in maintaining cell viability and growth. We also developed a simple and robust protocol for co-culture of these cells. Combined application of the GelMA hydrogels and the DEP technique is suitable for creating highly complex microscale tissues with important applications in fundamental cell biology and regenerative medicine in a rapid, accurate, and scalable manner.     

Application of differential pulse stripping voltammetry and chemometrics for the determination of three antibiotic drugs in food samples

A reliable method for simultaneous determination of three antibiotic drugs(levofloxacin,gatifloxacin and lomefloxacin) by differential pulse stripping voltammetry(DPSV) in Britton-Robinson buffer(pH 7.96) was presented.The method is based on adsorptive accumulation of the antibacterial drugs on a hanging mercury dropping electrode(HMDE),followed by the reduction of the adsorptive species by the technique of DPSV.Optimal conditions,the deposition time of 80 s,the deposition potential of—1250 mV,and the scan rate of 25 mV/s,were obtained.The linear concentration ranges of 0.010-0.080μg/mL were obtained for all these three antibiotic drugs,while the detection limits were 2.38,3.20 and 1.60ng/mL for levofloxacin,gatifloxacin and lomefloxacin,respectively.In this work,chemometrics methods,such as classical least squares(CLS),partial least squares(PLS), principle component regression(PCR) and radial basis function-artificial neural networks(RBF-ANN),were used to quantitatively resolve the overlapping signals.It was found that PCR gave the best results with total relative prediction error(RPE_T) of 7.71%.The proposed method was applied to determine these three drugs in several commercial food samples with spiked method and yielded satisfactory recoveries.     

Etude Des Propriétés Physico-Chimiques De ZnRb 4 (P 3 O 9 ) 2 ·6H 2 O

The dehydration of ZnRb 4 (P 3 O 9 ) 2 ·;6H 2 O was investigated, between 25 and 600°;C, by TG-DTA, X-ray diffraction, IR. It leads, between 300 and 500°;C, to a mixture of long chain polyphosphates RbPO 3 and ZnRb 2 (PO 3 ) 4 which stays stable until its melting point. The IR (1400-30 cm m 1 ) and Raman spectra (1400-100 cm m 1 ) of ZnRb 4 (P 3 O 9 ) 2 ·;6H 2 O are reported and assignments of fundamental modes proposed and compared with theoretical results obtained via the MNDO method for P 3 O 9 ring with C s symmetry. (La déshydratation, sous pression atmosphérique, du cyclotriphosphate ZnRb 4 (P 3 O 9 ) 2 ·;6H 2 O, a ét´;e effectuée, entre 25 and 600°;C, par spectrométrie IR, diffraction des rayons X, ATG et ATD. Elle conduit, entre 300 and 500°;C, au mélange de polyphosphates RbPO 3 et ZnRb 2 (PO 3 ) 4 qui reste stable jusqu'à la fusion. Les spectres vibrationnels IR (1400-30 cm m 1 ) et Raman (1400-100 cm m 1 ) du sel étudié ont été interprétés dans le domaine des vibrations de valence et de déformation du cycle P 3 O 9 et comparés avec les résultats des calculs théoriques par la méthode MNDO pour un cycle isolé de symétrie C s .)