Synthesis of a versatile (S)-3-(hydroxymethyl)butane-1,2,4-triol building block and its application for the stereoselective synthesis of N-homoceramides

[structures: see text] A versatile (S)-3-(hydroxymethyl)butane-1,2,4-triol building block has been synthesized starting from D-isoascorbic acid, a common food preservative. The key transformation in this approach was the introduction of branching through a high yield and fully regioselective epoxide opening. This flexible synthon has been elaborated to a new class of (dihydro-)N-homo(phyto)ceramides.     

Collaborative study for the detection of toxic compounds in shellfish extracts using cell-based assays. Part I: screening strategy and pre-validation study with lipophilic marine toxins

Human poisoning due to consumption of seafood contaminated with phycotoxins is a worldwide problem, and routine monitoring programs have been implemented in various countries to protect human consumers. Following successive episodes of unexplained shellfish toxicity since 2005 in the Arcachon Bay on the French Atlantic coast, a national research program was set up to investigate these atypical toxic events. Part of this program was devoted to fit-for-purpose cell-based assays (CBA) as complementary tools to collect toxicity data on atypical positive-mouse bioassay shellfish extracts. A collaborative study involving five laboratories was conducted. The responses of human hepatic (HepG2), human intestinal (Caco2), and mouse neuronal (Neuro2a) cell lines exposed to three known lipophilic phycotoxins-okadaic acid (OA), azaspiracid-1 (AZA1), and pectenotoxin-2 (PTX2)-were investigated. A screening strategy composed of standard operating procedures and a decision tree for dose-response modeling and assay validation were designed after a round of "trial-and-error" process. For each toxin, the shape of the concentration-response curves and the IC(50) values were determined on the three cell lines. Whereas OA induced a similar response irrespective of the cell line (complete sigmoid), PTX2 was shown to be less toxic. AZA1 induced cytotoxicity only on HepG2 and Neuro2a, but not on Caco2. Intra- and inter-laboratory coefficients of variation of cell responses were large, with mean values ranging from 35 to 54 % and from 37 to 48 %, respectively. Investigating the responses of the selected cell lines to well-known toxins is the first step supporting the use of CBA among the panel of methods for characterizing atypical shellfish toxicity. Considering these successful results, the CBA strategy will be further applied to extracts of negative, spiked, and naturally contaminated shellfish tissues.     

Simultaneous determination of three 5-nitroimidazoles in foodstuffs by differential pulse voltammetry and chemometrics

The voltammetric behaviour of three 5-nitroimidazoles,metronidazole,tinidazole and ornidazole,was investigated,and a method was developed for the simultaneous determination of these compounds,based on their reduction at a hanging mercury drop electrode(HMDE) in pH 8.95 buffer with differential pulse voltammetric(DPV) approach.Well defined voltammetric waves with peak potentials of -692,-640 and -652 mV were observed for these compounds,respectively.It is difficult to determine them individually from their mixtures without preseparation,for their voltammetric peaks overlapped seriously,so the chemometrics were used to resolve the overlapped voltammogram and quantify the mixtures.The proposed method was successfully applied to the determination of three 5-nitroimidazoles in milk and honey samples.     

2,2,5,5-tetramethylpyrrolidin-3-one-1-sulfinyl group for 5'-hydroxyl protection of deoxyribonucleoside phosphoramidites in the solid-phase preparation of DNA oligonucleotides

Several nitrogen-sulfur reagents have been investigated as potential 5'-hydroxyl protecting groups for deoxyribonucleoside phosphoramidites to improve the synthesis of oligonucleotides on glass microarrays. Out of the nitrogen-sulfur-based protecting groups so far investigated, the 2,2,5,5-tetramethylpyrrolidin-3-one-1-sulfinyl group exhibited near optimal properties for 5'-hydroxyl protection by virtue of the mildness of its deprotection conditions. Specifically, the iterative cleavage of a terminal 5'-sulfamidite group in the synthesis of 5'-d(ATCCGTAGCCAAGGTCATGT) on controlled-pore glass is efficiently accomplished by treatment with iodine in the presence of an acidic salt. Hydrolysis of the oligonucleotide to its 2'-deoxyribonucleosides upon exposure to snake venom phosphodiesterase and bacterial alkaline phosphatase did not reveal the formation of any nucleobase adducts or other modifications. These findings indicate that the 2,2,5,5-tetramethylpyrrolidin-3-one-1-sulfinyl group for 5'-hydroxyl protection of phosphoramidites, such as 10a-d, may lead to the production of oligonucleotide microarrays exhibiting enhanced specificity and sensitivity in the detection of nucleic acid targets.     

Chemoselective Catalysis with Organosoluble Lewis Acidic Polyoxotungstates

The preparation of new organosoluble Lewis acidic polyoxometalates (POMs) is reported. These complexes were prepared by the incorporation of Zr, Sc, and Y atoms into the corresponding monolacunary Dawson [P₂W₁₇O₆₁]^10? and Keggin [PW₁₁O₃₉]^7? polyoxotungstates. The catalytic activity of these compounds was evaluated for C? C bond formation in the Diels–Alder, Mannich, and Mukaiyama‐type reactions. Comparisons with previously described Lewis acidic POMs are reported. Competitive reactions between imines and aldehydes or between various imines demonstrated that fine tuning of the reactivity could be reached by varying the metal atom incorporated into the polyanionic framework. A series of experiments that employed pyridine derivatives allowed us to distinguish between the Lewis and induced Brønsted acidity of the POMs. These catalysts activate imines in a Lewis acidic way, whereas aldehydes are activated by indirect Brønsted catalysis.     

One-pot synthesis of new tetrasubstituted thiophenes and selenophenes

In this work, we described the synthesis of new tetrasubstituted thiophenes and selenophenes achieved by an easy one-pot four-step procedure. Expected compounds were obtained in good yield from ketene dithioacetals.     

Simultaneous Voltammetric Determination of Three Herbicides in Food and Water Samples with the Aid of Chemometrics

Differential pulse stripping voltammetry method(DPSV) was applied to the determination of three herbicides,ametryn,cyanatryn,and dimethametryn.It was found that their voltammograms overlapped strongly,and it is difficult to determine these compounds individually from their mixtures.With the aid of chemometrics,classical least squares(CLS),principal component regression(PCR) and partial least squares(PLS),voltammogram resolution and quantitative analysis of the synthetic mixtures of the three compounds were successfully performed.The proposed method was also applied to the analysis of some real samples with satisfactory results.