Enantiomeric separation of chiral peptide nucleic acid monomers by capillary electrophoresis with charged cyclodextrins

Direct chiral separation of chiral peptide nucleic acid (PNA) monomers has been achieved for the first time by capillary electrophoresis (CE) with charged cyclodextrins as chiral selectors added to the electrophoretic buffer. Selectively modified 6-deoxy-6-N-histamino-beta-cyclodextrin and sulfobutyl ether-beta-CD were successfully used as chiral selectors for the enantiomeric separation of chiral monomers based on different aminoethylamino acids bearing thymine or adenine as nucleobases. Chiral separations were obtained at low selector concentrations (1-3 mM) with good enantioselectivity and resolution factors. Separations were optimized as a function of pH in order to exploit the effect of the electrostatic interactions between the oppositely charged selector and selectand. The method has been applied to the analysis of the enantiomeric excess of chiral monomers used for the solid phase synthesis of chiral PNA oligomers. CE chiral analysis showed that a very high enantiomeric purity was generally achieved in the synthesis of all monomers, except for histidine and aspartic acid based monomers in which ca. 10% of the "wrong" enantiomer was always present.     

Partitioning of metals between the aqueous phase and suspended insoluble material in fog droplets

This paper discusses the partitioning of metals (K, Na, Ca, Mg, Al, Cu, Fe, Pb and Zn) between the aqueous phase and the suspended insoluble material in fog samples collected in the Po Valley during two extensive fields campaigns. Metals represent on average 11% of the mass of suspended insoluble matter, while the main component is carbon (both organic carbon, OC = 35%, and black carbon, BC = 8%). The unaccounted suspended matter mass is very high, on average 46%, and is attributable to non metallic species, such as O and N and of Si. The principal metals in the insoluble suspended fraction are Fe and Al (2-5%), while the contributions of other metals (Na, Mg, Cu, Pb and Zn) are lower than 1%. Ca and K exhibited high blank values and could not be detected above blank detection limit threshold. The main components in the aqueous phase are NO3- (34%), WSOC (23%), SO4(2-) (18%) and NH4+ (19%), while trace metals and remaining cations and anions accounted for less than 1% of solute mass. The main dissolved trace metals in fog droplets are Zn, Al and Fe, while the main metallic cations are Na and Ca. Fe and Al are the only metals preferentially distributed in the suspended insoluble matter of fog droplets (partitioning ratio respectively 37% and 33%). All other metals are mostly dissolved in the aqueous phase (mean partitioning ratios of Mg, Pb, Zn, Cu and Na are 69%, 70%, 77%, 81% and 87%). These findings are in agreement with literature data on metal speciation in cloud and rain samples. The dependence of partitioning ratios on pH is investigated for the different metals, with only Al showing a clear partitioning ratio decrease with increasing pH. Conversely, the other metals show no dependence or a complex and highly variable behaviour. The partitioning ratio of iron (mean 37%) observed in the Po Valley fog samples is much higher than the water extractable iron in aerosol particles (typically 1-2 %): this fact can be explained by differences in the aerosol sources and composition among sites and by chemical processes in the aqueous phase, such as complexation and redox reactions involving organic ligands (oxalate, or other organic acids as humic-like organic matter) which may promote Fe solubility.     

Rh(I) coordination chemistry of chiral alpha-aminophosphine(eta6-arene)chromium tricarbonyl ligands

The diastereoselective addition of Ph(2)PH to the chiral ortho-substituted eta(6)-benzaldimine complexes (eta(6)-o-X-C(6)H(4)CH=NAr)Cr(CO)(3) (1, X = MeO, Ar = p-C(6)H(4)OMe; 2, X = Cl, Ar = Ph) leads to the formation of the corresponding chiral aminophosphines (alpha-P,N) Ph(2)P-CH(Ar(1))-NHAr(2) (3, Ar(1) = o-C(6)H(4)(OCH(3))[Cr(CO)(3)], Ar(2) = p-C(6)H(4)OCH(3); 4, Ar(1) = o-C(6)H(4)Cl[Cr(CO)(3)], Ar(2) = Ph) in equilibrium with the starting materials. The uncomplexed benzaldimine (o-ClC(6)H(4)CH=NPh), 2', analogously produces an equilibrium amount of the corresponding aminophosphine Ph(2)P-CH(Ar(1))-NHAr(2) (4', Ar(1) = o-C(6)H(4)Cl, Ar(2) = Ph). Depending on the equilibrium constant, the subsequent addition of (1)/(2) equiv of [RhCl(COD)](2) (COD = 1,5-cyclooctadiene) leads to either Ph(2)PH oxidative addition in the case of 3 or to the corresponding [RhCl(COD)(alpha-P,N)] complexes [RhCl(COD)(Ph(2)P-CH[o-C(6)H(4)Cl[Cr(CO)(3)]]-NHPh)] (5) and [RhCl(COD)(Ph(2)P-CH(o-C(6)H(4)Cl)-NHPh)] (5') in the cases of the aminophosphines 4 and 4'. The addition of the latter ligands, as racemic mixtures, to (1)/(4) equiv of [Rh(CO)(2)Cl](2) leads to the [RhCl(CO)(alpha-P,N)(2)] complexes [RhCO(Ph(2)P-CH[o-C(6)H(4)Cl[Cr(CO)(3)]]-NHPh)(2)Cl] (7) or [RhCO(Ph(2)P-CH(o-C(6)H(4)Cl)-NHPh)(2)Cl] (7') as mixtures of (R(C),S(C))/(S(C),R(C)) and (R(C),R(C))/(S(C),S(C)) diastereomers. The rhodium complexes 5 and 7' have been fully characterized by IR and (31)P NMR spectroscopies and X-ray crystallography. These compounds exhibit intramolecular Rh-Cl.H-N interactions in the solid state and in solution. The stability of the new rhodium complexes has been studied under different CO pressures. Under 1 atm of CO, 5 is converted to an unstable complex [RhCl(CO)(2)(alpha-P,N)], 6, which undergoes ligand redistribution leading to 7 plus an unidentified complex. This reaction is inhibited under higher CO or syngas pressure, as confirmed by the observation of the same catalytic activity in hydroformylation when styrene was added to a catalytic mixture that was either freshly prepared or left standing for 20 h under high CO pressure.     

Within the Ischemic Penumbra,Sub-Cellular Compartmentalization of Heat Shock Protein 70 Overlaps with Autophagy Proteins and Fails to Merge with Lysosomes

The brain area which surrounds the frankly ischemic region is named the area penumbra. In this area, most cells are spared although their oxidative metabolism is impaired. area penumbra is routinely detected by immunostaining of a molecule named Heat Shock Protein 70 (HSP70). Within the area penumbra, autophagy-related proteins also increase. Therefore, in the present study, the autophagy-related microtubule-associated protein I/II-Light Chain 3 (LC3) was investigated within the area penumbra along with HSP70. In C57 black mice, ischemia was induced by permanent occlusion of the distal part of the middle cerebral artery. Immunofluorescence and electron microscopy show that LC3 and HSP70 are overexpressed and co-localize within the area penumbra in the same cells and within similar subcellular compartments. In the area penumbra, marked loss of co-localization of HSP70 and LC3-positive autophagy vacuoles, with lysosomal-associated membrane protein 1 (LAMP1) or cathepsin-D-positive lysosome vacuoles occurs. This study indicates that, within the area penumbra, a failure of autophagolysosomes depends on defective compartmentalization of LC3, LAMP1 and cathepsin-D and a defect in merging between autophagosomes and lysosomes. Such a deleterious effect is likely to induce a depletion of autophagolysosomes and cell clearing systems, which needs to be rescued in the process of improving neuronal survival.     

Which Extraction Solvents and Methods Are More Effective in Terms of Chemical Composition and Biological Activity of Alcea fasciculiflora from Turkey?

The bioactive content, antioxidant properties, and enzyme inhibition properties of extracts of Alcea fasciculiflora from Turkey prepared with different solvents (water, methanol, ethyl acetate) and extraction methods (maceration, soxhlet, homogenizer assisted extraction, and ultrasound assisted extraction) were examined in this study. UHPLC-HRMS analysis detected or annotated a total of 50 compounds in A. fasciculiflora extracts, including 18 hydroxybenzoic and hydroxycinnamic acids, 7 Hexaric acids, 7 Coumarins, 15 Flavonoids, and 3 hydroxycinnamic acid amides. The extracts had phenolic and flavonoid levels ranging from 14.25 to 24.87 mg GAE/g and 1.68 to 25.26 mg RE/g, respectively, in the analysis. Both DPPH and ABTS tests revealed radical scavenging capabilities (between 2.63 and 35.33 mg TE/g and between 13.46 and 76.27 mg TE/g, respectively). The extracts had reducing properties (CUPRAC: 40.38–78 TE/g and FRAP: 17.51–42.58 TE/g). The extracts showed metal chelating activity (18.28–46.71 mg EDTAE/g) as well as total antioxidant capacity (phosphomolybdenum test) (0.90–2.12 mmol TE/g). DPPH, ABTS, FRAP, and metal chelating tests indicated the water extracts to be the best antioxidants, while the ethyl acetate extracts had the highest overall antioxidant capacity regardless of the extraction technique. Furthermore, anti-acetylcholinesterase activity was identified in all extracts (0.17–2.80 mg GALAE/g). The water extracts and the ultrasound-assisted ethyl acetate extract were inert against butyrylcholinesterase, but the other extracts showed anti-butyrylcholinesterase activity (1.17–5.80 mg GALAE/g). Tyrosine inhibitory action was identified in all extracts (1.79–58.93 mg KAE/g), with the most effective methanolic extracts. Only the ethyl acetate and methanolic extracts produced by maceration and homogenizer aided extraction showed glucosidase inhibition (0.11–1.11 mmol ACAE/g). These findings showed the overall bioactivity of the different extracts of A. fasciculiflora and provided an overview of the combination of solvent type and extraction method that could yield bioactive profile and pharmacological properties of interest and hence, could be a useful reference for future studies on this species.     

Identification of Human Dihydroorotate Dehydrogenase Inhibitor by a Pharmacophore-Based Virtual Screening Study

Human dihydroorotate dehydrogenase (hDHODH) is an enzyme belonging to a flavin mononucleotide (FMN)-dependent family involved in de novo pyrimidine biosynthesis, a key biological pathway for highly proliferating cancer cells and pathogens. In fact, hDHODH proved to be a promising therapeutic target for the treatment of acute myelogenous leukemia, multiple myeloma, and viral and bacterial infections; therefore, the identification of novel hDHODH ligands represents a hot topic in medicinal chemistry. In this work, we reported a virtual screening study for the identification of new promising hDHODH inhibitors. A pharmacophore-based approach combined with a consensus docking analysis and molecular dynamics simulations was applied to screen a large database of commercial compounds. The whole virtual screening protocol allowed for the identification of a novel compound that is endowed with promising inhibitory activity against hDHODH and is structurally different from known ligands. These results validated the reliability of the in silico workflow and provided a valuable starting point for hit-to-lead and future lead optimization studies aimed at the development of new potent hDHODH inhibitors.     

Exploring the Parallel G-Quadruplex Nucleic Acid World: A Spectroscopic and Computational Investigation on the Binding of the c-myc Oncogene NHE III1 Region by the Phytochemical Polydatin

Trans-polydatin (tPD), the 3-β-D-glucoside of the well-known nutraceutical trans-resveratrol, is a natural polyphenol with documented anti-cancer, anti-inflammatory, cardioprotective, and immunoregulatory effects. Considering the anticancer activity of tPD, in this work, we aimed to explore the binding properties of this natural compound with the G-quadruplex (G4) structure formed by the Pu22 [d(TGAGGGTGGGTAGGGTGGGTAA)] DNA sequence by exploiting CD spectroscopy and molecular docking simulations. Pu22 is a mutated and shorter analog of the G4-forming sequence known as Pu27 located in the promoter of the c-myc oncogene, whose overexpression triggers the metabolic changes responsible for cancer cells transformation. The binding of tPD with the parallel Pu22 G4 was confirmed by CD spectroscopy, which showed significant changes in the CD spectrum of the DNA and a slight thermal stabilization of the G4 structure. To gain a deeper insight into the structural features of the tPD-Pu22 complex, we performed an in silico molecular docking study, which indicated that the interaction of tPD with Pu22 G4 may involve partial end-stacking to the terminal G-quartet and H-bonding interactions between the sugar moiety of the ligand and deoxynucleotides not included in the G-tetrads. Finally, we compared the experimental CD profiles of Pu22 G4 with the corresponding theoretical output obtained using DichroCalc, a web-based server normally used for the prediction of proteins’ CD spectra starting from their “.pdb” file. The results indicated a good agreement between the predicted and the experimental CD spectra in terms of the spectral bands’ profile even if with a slight bathochromic shift in the positive band, suggesting the utility of this predictive tool for G4 DNA CD investigations.     

On the integrability of Degasperis–Procesi equation: Control of the Sobolev norms and Birkhoff resonances

We consider the dispersive Degasperis–Procesi equation $u_t?u_{xxt}?\mathtt{c}{u}_{xxx}+4\mathtt{c}{u}_x?u{u}_{xxx}?3u_x{u}_{xx}+4u{u}_x=0$ with $\mathtt{c}\in \mathbb{R}?\{0\}$. In [15] the authors proved that this equation possesses infinitely many conserved quantities. We prove that there are infinitely many of such constants of motion which control the Sobolev norms and which are analytic in a neighborhood of the origin of the Sobolev space $H^s$ with $s\ge 2$, both on $\mathbb{R}$ and $\mathbb{T}$. By the analysis of these conserved quantities we deduce a result of global well-posedness for solutions with small initial data and we show that, on the circle, the formal Birkhoff normal form of the Degasperis–Procesi at any order is action-preserving.     

Fractional powers of the noncommutative Fourier's law by the S‐spectrum approach

Let e_?, for ? = 1,2,3, be orthogonal unit vectors in and let be a bounded open set with smooth boundary ?Ω. Denoting by a point in Ω, the heat equation, for nonhomogeneous materials, is obtained replacing the Fourier law, given by the following: into the conservation of energy law, here a, b, are given functions. With the S‐spectrum approach to fractional diffusion processes we determine, in a suitable way, the fractional powers of T. Then, roughly speaking, we replace the fractional powers of T into the conservation of energy law to obtain the fractional evolution equation. This method is important for nonhomogeneous materials where the Fourier law is not simply the negative gradient. In this paper, we determine under which conditions on the coefficients a, b, the fractional powers of T exist in the sense of the S‐spectrum approach. More in general, this theory allows to compute the fractional powers of vector operators that arise in different fields of science and technology. This paper is devoted to researchers working in fractional diffusion and fractional evolution problems, partial differential equations, and noncommutative operator theory.