Miniaturised isotachophoresis analysis

The application of miniaturized total analysis systems (microTAS) has seen rapid development over the past few years. Isotachophoresis (ITP) has been transferred into microchip format for both electrophoretic separation and pretreatment purposes, due to its advantageous features including separation parameters controlled by electrolyte composition and high sample load capacity. The primary focus of this concise review is to summarize the basic features of microchip based ITP and its applications to the analysis and pretreatment of ionic compounds and biomolecules that have arisen since 1998.     

Inert benzothiazole functionalised ruthenium(II) complexes; potential DNA hairpin binding agents

The two enantiomers of [Ru(bpy)2(bbtb)]2+{bpy = 2,2'-bipyridine; bbtb = 4,4'-bis(benzothiazol-2-yl)-2,2'-bipyridine} have been isolated and fully characterised. Both enantiomers have been shown to have a strong association with calf thymus DNA by UV/visible absorption, emission and CD spectroscopy, with the Lambda enantiomer having the greater affinity. The binding of both enantiomeric forms of [Ru(bpy)2(Me2bpy)]2+ and [Ru(bpy)2(bbtb)]2+{Me(2)bpy = 4,4'-dimethyl-2,2'-bipyridine} to a range of oligonucleotides, including an octadecanucleotide and an icosanucleotide which contain hairpin-sequences, have been studied using a fluorescent intercalator displacement (FID) assay. The complex [Ru(bpy)2(bbtb)]2+ exhibited an interesting association with hairpin oligonucleotides, again with the Lambda enantiomer binding more strongly. A (1)H NMR spectroscopic study of the binding of both enantiomers of [Ru(bpy)2(bbtb)]2+ to the icosanucleotide d(CACTGGTCTCTCTACCAGTG) was conducted. This sequence contains a seven-base-pair duplex stem and a six-base hairpin-loop. The investigation gave an indication of the relative binding of the complexes between the two different regions (duplex and secondary structure) of the oligonucleotide. The results suggest that both enantiomers bind at the hairpin, with the ruthenium centre located at the stem-loop interface. NOE studies indicate that one of the two benzothiazole substituents of the bbtb ligand projects into the loop-region. A simple model of the metal complex/oligonucleotide adduct was obtained by means of molecular modelling simulations. The results from this study suggest that benzothiazole complexes derived from inert polypyridine ruthenium(II) complexes could lead to the development of new fluorescent DNA hairpin binding agents.     

Spectroscopically encoded resins for high throughput imaging time-of-flight secondary ion mass spectrometry

Spectroscopic barcoding was recently introduced as a new pre-encoding strategy wherein the resin beads are not just carriers for solid phase synthesis, but are, in addition, the repository of the synthetic scheme to which they were subjected. To expand the repertoire of spectroscopically barcoded resins (BCRs), here we introduce a new family of halogenated polystyrene-based polymers designed for high-throughput combinatorial analysis using not only infrared and Raman spectroscopy but also imaging time-of-flight secondary ion mass spectrometry (ToF-SIMS). In particular, we have established that (a) the halogen content of these new resins can be used as an encoding element in quantitative imaging ToF-SIMS and (b) the number of styrene monomers used to generate unique vibrational fingerprints can be significantly reduced by using monomers in different molar ratios. The combination of quantitative imaging ToF-SIMS and vibrational spectroscopy is anticipated to dramatically increase the repertoire of possible BCRs from a few hundreds to several thousands.     

Oximetry of oxygen supersaturated solutions using nitroxides as EPR probe

The broadening of the three hyperfine EPR nitroxide lines in oxygen supersaturated solutions was examined. The solutions were supersaturated with oxygen either by thermal decomposition of 1,4-peroxy-1,4-dimethylnaphthalene or by pressurizing molecular oxygen above the sample solution. The linear relationship between the Lorentzian component of the line width and the O(2) concentration was proven to hold even when the hyperfine splitting is unresolved. In this region of line broadening, the requirement for spectral simulation is discussed.     

TOF-SIMS evidence of intercalated molecular gases and diffusion-limited reaction kinetics in an alpha particle-irradiated PTFE matrix

The chemical evolution of poly(tetrafluoroethylene) (PTFE) that is brought about by increasing levels of irradiation with alpha particles is accompanied by the emergence and proliferation of functionalized moieties. Families of reaction products specifically identified in the alpha-irradiated polymer matrix include hydride-, hydroxide-, and oxide-functionalized fluorocarbons. The data also indicate the emergence of hydrogen peroxide (H2O2) and hydrazine (N2H4), but no distinct evidence suggesting the formation of perfluorinated amines, amides, or cyanogens is found. In this article we substantiate the speciation of emergent species and reveal evidence of intercalated molecular gases with which alpha particle-generated radicals may react to form the observed products. Furthermore, we present evidence to suggest that the kinetics of alpha particle-induced reaction is limited by the diffusion of radicals within the polymer matrix. That is to say, chemical additives in the polymer matrix are shown to be scavengers of H*, O*, and F* radicals and limit the rates of reaction that produce functionalized fluorocarbon moieties. Above a threshold dose of alpha particles, the concentration of radicals exceeds that of the scavenger species, and free radical diffusion commences as evidenced by a sudden increase in the yield of reaction products. Samples of PTFE were irradiated to alpha doses in the range of 10(7) to 5 x 10(10) rad with 5.5 MeV 4He2+ ions from a tandem accelerator. Residual gas analysis (RGA) was utilized to monitor the liberation of molecular gases from PTFE during alpha particle irradiation of samples in vacuum. Static time-of-flight SIMS (TOF-SIMS), equipped with a 20 keV C60+ source, was employed to probe chemical changes as a function of alpha particle irradiation. Chemical images and high-resolution mass spectra were collected in both the positive and negative polarities.     

Fabry-Perot fringes and their application to study the film growth, chain rearrangement, and erosion of hydrogen-bonded PVPON/PAA films

We observed Fabry-Perot fringes in the absorption spectra of hydrogen-bonded layer-by-layer (LBL) films of poly(vinyl pyrrolidone) (PVPON) and poly(acrylic acid) (PAA), which stem from the interferences between beams transmitted and partially reflected at the highly smooth film-air interface and film-quartz interface. The appearance and disappearance of Fabry-Perot fringes can be used to evaluate the homogeneity of the film. They also provide information about the film thickness. Using this optical phenomenon, with a minimal requirement of instrumentation, we studied the effect of several experimental conditions on the film buildup and structure. The film grows linearly with dipping cycles. Films fabricated from higher molecular weight polymers tend to be thicker. Increasing the concentration of the assembly solutions can also make thicker films. However, films from high molecular weight polymers or high concentration assembly solutions may be heterogeneous and do not display Fabry-Perot fringes in their absorption spectra. The defects in these heterogeneous films can be healed by a postannealing in water or diluted HCl to allow the chain rearrangement to complete. We further found the PVPON/PAA films can be eroded by long-term annealing in water or diluted HCl by monitoring the movement of the Fabry-Perot fringes. In most cases, the erosion rate is constant with annealing time. The erosion rate decreases with a decrease in the pH of the media and an increase in the molecular weight of the polymers.     

Cesium Recognition by Supramolecular Assemblies of 2-Benzylphenol and 2-Benzylphenolate

Extraction experiments show that 2-benzylphenol is an efficient and selective extractant for cesium. The structures of cesium and potassium 2-benzylphenolate were determined. Both structures also contain 2-benzylphenol, which ligates the cation, through its phenolic oxygen atom and the benzyl ring. The phenolate oxygen atom does not directly contact the cation in either structure, but is a hydrogen-bond acceptor to the 2-benzylphenol ligands, forming a supramolecular assembly. For comparison to the bound ligands, the structure of 2-benzylphenol was also determined. Molecular mechanics and ab initio molecular orbital theory are used to rationalize several aspects of Cs/Na selectivity.