Origin of organic gaseous products formed in the thermal decomposition of formates

The gaseous products of the thermal decomposition of formates have been investigated and compared with the products of formaldehyde and synthesis gas transformation under analogous conditions in the presence of the solids formed in the thermal decomposition of particular formates. It was found that formaldehyde transformation leads to organic compounds identical to those obtained in the thermal decomposition of the respective formates, while synthesis gas does not react under such conditions. This fact substantiates the hypothesis that formaldehyde is a precursor of the organic compounds identified in the thermal decomposition of formates. The nature of the organic componds obtained in the thermal decomposition of formates indicates that the formaldehyde formed in the initial stages is then transformed in the Cannizzaro or Tishchenko reactions.

---

Zusammenfassung Die gasförmigen Produkte der thermischen Zersetzung von Formiaten wurden untersucht und mit den Produkten verglichen, die bei der Umwandlung von Formaldehyd und Synthesegas unter analogen Bedingungen in Gegenwart von bei der thermischen Zersetzung von speziellen Formiaten gebildeten Feststoffen entstehen. Formaldehydumwandlungen führen zu organischen Verbindungen, die identisch mit denen sind, die bei der thermischen Zersetzung des betreffenden Formiats gebildet werden, während Synthesegas unter solchen Bedingungen nicht reagiert. Dies erhärtet die Hypothese, daß Formaldehyd eine Vorstufe der bei der thermischen Zersetzung von Formiaten identifizierten organischen Verbindungen ist. Die Natur der bei der thermischen Zersetzung von Formiaten auftretenden organischen Verbindungen weist darauf hin, daß das in den ersten Reaktionsschritten gebildete Formaldehyd nach der Cannizzaro-oder Tishchenko-Reaktion weiterreagiert.

---

, , . , i , . . , , . , , , .

     

Reibungsdämpfung durch Scheuerleisten: Ein praxisgerechtes Auslegungskonzept

Übersicht Die Fugen zusammengesetzter Bauteile sind einerseits für eine nachteilige Steifigkeitsminderung verantwortlich, tragen aber andererseits durch Reibungsvorgänge wesentlich zum Dämpfungsvermögen einer Konstruktion bei. Merkliche Reibungsdämpfung ohne gleichzeitigen Steifigkeitsverlust bewirken zusätzliche Fugen, die durch Anbringen sogenannter Scheuerleisten entstehen. Der Autor stellt ein Näherungsverfahren zur dämpfungsoptimalen Auslegung von Scheuerleisten vor. Ausgehend von der zu dämpfenden Schwingungsform liefert dieses Verfahren Kriterien für eine günstige Scheuerleistenanordnung, geeignete Leistenabmessungen und als wichtigstes Ergebnis eine dämpfungsoptimale Fugenpressung, die zu maximaler Energiedissipation führt. Schließlich kann das zu erwartende Dämpfungsmaß berechnet und damit das Ergebnis einer vorgesehenen Dämpfungsmaßnahme abgeschätzt werden.

---

Damping by friction ledges: a practical design concept

Summary On the one hand, mating surfaces of structures are responsible for a reduction of stiffness, on the other hand relative motion produces friction, which contributes considerably to the damping. Noticeable friction damping without simultaneous stiffness reduction can be achieved by adding further mating surfaces. Such interfaces are realized by fastening additional elements (e.g. beamlike) onto the structure. An analytic approximation method for these so-called friction ledges is described in this paper. Initiating from the mode shape to be damped the procedure yields criteria for the suitable positioning and design of the ledges. Most important of all is the damping optimized interface pressure, that leads to maximum energy dissipation. Finally, the expected damping rate can be computed, and therefore the result of the proposed measure assessed.

     

Quantum spheres

Spaces homogeneous under the action of the quantum SU(2) group are introduced and investigated. These spaces can be considered as noncommutative two-dimensional spheres of different radii. The geometry of the space built from those spheres makes possible one-particle dipole electric transitions with l=0.     

Ab initio study of the NMR shielding constants and spin-spin coupling constants in cyclopropene

Summary Ab initio calculations of parameters which characterize the NMR spectrum are presented for the cyclopropene molecule. The London orbitals CHF (or GIAO-CHF, Gauge-Independent Atomic Orbital Coupled Hartree-Fock) results for the shielding constants are in good agreement with the experimental data, accurately determined, and with otherab initio values. The calculations of the NMR spin-spin coupling constants have been performed using the Multiconfiguration Time-Dependent Hartree-Fock (MC TDHF) approach. Different basis sets and MC SCF wavefunctions were used to estimate the accuracy of the results. Good agreement is obtained with the coupling constants estimated using the available experimental data.Dedicated to Professor Werner Kutzelnigg on the occasion of his 60th birthday     

2,2,5,5-tetramethylpyrrolidin-3-one-1-sulfinyl group for 5'-hydroxyl protection of deoxyribonucleoside phosphoramidites in the solid-phase preparation of DNA oligonucleotides

Several nitrogen-sulfur reagents have been investigated as potential 5'-hydroxyl protecting groups for deoxyribonucleoside phosphoramidites to improve the synthesis of oligonucleotides on glass microarrays. Out of the nitrogen-sulfur-based protecting groups so far investigated, the 2,2,5,5-tetramethylpyrrolidin-3-one-1-sulfinyl group exhibited near optimal properties for 5'-hydroxyl protection by virtue of the mildness of its deprotection conditions. Specifically, the iterative cleavage of a terminal 5'-sulfamidite group in the synthesis of 5'-d(ATCCGTAGCCAAGGTCATGT) on controlled-pore glass is efficiently accomplished by treatment with iodine in the presence of an acidic salt. Hydrolysis of the oligonucleotide to its 2'-deoxyribonucleosides upon exposure to snake venom phosphodiesterase and bacterial alkaline phosphatase did not reveal the formation of any nucleobase adducts or other modifications. These findings indicate that the 2,2,5,5-tetramethylpyrrolidin-3-one-1-sulfinyl group for 5'-hydroxyl protection of phosphoramidites, such as 10a-d, may lead to the production of oligonucleotide microarrays exhibiting enhanced specificity and sensitivity in the detection of nucleic acid targets.     

Synthesis of Functionalized (2-Thienylcarbonyl)thiazoles and 4-(2-Thienyl)pyridines by Reaction of (2-Thienylcarbonyl)thioacetanilides and their Enamine Derivatives

Summary. The condensation of two molecules of 2-(2-thienylcarbonyl)thioacetanilides catalyzed by piperidine yielded thiazole derivatives as confirmed by X-ray crystal structure analysis. The reaction of malononitrile with 3-morpholino-3-(2-thienyl)acrylic acid thioanilides furnished 6-amino-1-aryl-4-(2-thienyl)-1,2-dihydro-2-thioxopyridine-5-carbonitriles. A similar reaction of malononitrile with 3-morpholino-3-(2-thienyl)acrylic acid anilides provided 2-oxopyridine-5-carbonitriles.     

Effect of silica-type sol-gel carrier’s structure and morphology on a supported Ziegler-Natta catalyst for ethylene polymerization

Silica xerogels with different structures and morphology, synthesized using a sol-gel procedure, were used as a carrier of vanadium catalysts (VOCl₃/AlEt₂Cl) for ethylene polymerization. Two techniques of catalyst synthesis were applied: slurry impregnation and gas-phase adsorption and the relevant polymerization methods were then employed. The effect of the carrier structure and morphology on the vanadium loading in the catalysts, the catalyst’s activity and kinetic stability were investigated.     

Tetraphenylporphyrins monosubstituted with a crown ether in one phenyl ring. Synthesis and characterization

Summary The synthesis and spectroscopic characterization of seven new tetraphenyl-porphyrins (1–7) derivatized with 12-crown-4, 14-crown-4, 15-crown-5, or 18-crown-6 ether units inortho orpara position of one of the phenyl rings is described.

---

In einem Phenylring mit Kronenethern monosubstituierte Tetraphenylporphyrine. Synthese und Charakterisierung

Zusammenfassung Die Synthese und die spektroskopische Charakterisierung sieben neuer Tetraphenylporphyrine (1–7), die mit 12-Krone-4, 14-Krone-4, 15-Krone-5 oder 18-Krone-6 in derortho-oderpara-Position eines Phenylrings substituiert sind, werden beschrieben.

     

The IINS, IR and DFT studies of hydrogen bonds in 6-Furfuryl and 6-Benzylaminopurines

FTIR and IINS spectra of 6-Furfurylaminopurine (6-FAP) and 6-Benzylaminopurine (6-BAP) taken at different temperatures have been analysed and compared with the spectra calculated by the ab initio DFT/B3LYP method and the semiempirical PM3 method in the isolated molecule approximation, for the tautomers N3-H, N7-H and N9-H, and dimers with hydrogen bonds. For 6-FAP the best agreement between the calculated and experimental (at 20 K) spectra has been found for the N9-H tautomer, whose structure was established by X-ray diffraction. For 6-BAP the analogous agreement for the N9-H tautomer structure has been poor and much better for the N7-H tautomer. The vibrational spectra calculated for dimers of the molecules studied involved in hydrogen bonds, permitted also an interpretation of the bands whose positions and FWHM in the FTIR spectra changed with temperature.