Nanostructured polymetallaynes of controlled length: Synthesis and characterization of oligomers and polymers from 1,1′‐bis‐(ethynyl)4,4′‐biphenyl bridging Pt(II) or Pd(II) centers

The reactivity of square planar palladium(II) and platinum(II) complexes in trans or cis configuration, namely trans or cis‐[dichlorobis(tributylphosphine)platinum(II)] and trans‐[dichlorobis(tributylphosphine)palladium(II)] with 1,1′‐bis(ethynyl) 4,4′‐biphenyl, DEBP, leading to π‐conjugated organometallic oligomeric and polymeric metallaynes, was investigated by a systematic variation of the reaction conditions. The formation of polymers and oligomers with defined chain length [? M(PBu₃)₂ (C?C? C₆H₄? C₆H₄? C?C? )]_n (n = 3–10 for the oligomers, n = 20–50 for the polymers) depends on the configuration of the precursor Pt(II) and Pd(II) complexes, the presence/absence of the catalyst CuI, and the reaction time. A series of model reactions monitored by XPS, GPC, and NMR ³¹P spectroscopy showed the route to modulate the chain growth. As expected, the nature of the transition metal (Pt or Pd) and the molecular weight of the polymers markedly influence the photophysical characteristics of the polymetallaynes, such as optical absorption and emission behavior. Polymetallaynes with nanostructured morphology could be obtained by a simple casting procedure of polymer solutions. © 2007 Wiley Periodicals, Inc. J Polym Sci Part A: Polym Chem 45: 3311–3329, 2007     

Solid-state interactions and drug release of teicoplanin in binary combinations with peracetylated α-, β-, and γ-cyclodextrins

Triacetyl α-cyclodextrin, triacetyl β-cyclodextrin and triacetyl γ-cyclodextrin were tested as possible hydrophobic carriers to prolong the release of hydrophilic teicoplanin (TCP). Physical–chemical characterization of individual components, drug-carrier physical mixtures at 0.5, 0.67 and 0.75 mass fraction of carrier, and the respective interaction products by kneading or evaporative crystallization under microwave irradiation was carried out using differential scanning calorimetry (DSC) and thermogravimetric analysis (TGA). In vitro drug release in pH 7.4 phosphate buffer at 37 °C was determined by intrinsic dissolution rate (IDR) measurements on non disintegrating compressed discs. Solid-state interactions of TCP with triacetyl α-cyclodextrin by evaporative crystallization and kneading and with triacetyl β-cyclodextrin by evaporative crystallization (probably resulting in carrier amorphization) were demonstrated. The role of carrier hydrophobicity, carrier mass fraction and preparation method of solid drug-carrier combinations on solid-state drug-carrier interactions and slowing down of TCP release was assessed. Modulation of drug release can be achieved using TCP-triacetyl γ-cyclodextrin combinations at 0.5 mass fraction of carrier.     

A new multi analytical approach for the identification of synthetic and natural dyes mixtures. The case of orcein-mauveine mixture in a historical dress of a Sicilian noblewoman of nineteenth century

Abstract

In this paper, the application of a multi-analytical approach for the characterisation of synthetic and natural dyes in a historical textile is presented. The work is focused on a historical dress of a Sicilian noblewoman, dating from about 1865–1870. Firstly, SERS on fibre was performed, in order to individuate the classes of dyes employed. The SERS spectra suggested the presence of two main dyes: mauveine and orcein. In order to confirm these preliminary results, two different extraction protocols were applied. The extracts obtained were analysed by ESI-MS, MALDI-ToF and UHPCL-MS analyses, confirming the SERS results. In particular, the application of the ammonia mild extraction technique allowed to selectively extract the phenoxazonic dyes, separating them already in the extraction step from the synthetic ones. Thanks to this multi-analytical approach, this dress could be considered as one of the first examples of employment of synthetic dyes in association with natural ones.     

Unexpected 1,2,3-triazole formation in the reaction of diethylaluminum azide with α′-amino-α,β-unsaturated ketones

4-Acyl-1H-1,2,3-triazoles are formed from diethylaluminum azide and α′-(N,N-dibenzylamino)-α,β-unsaturated ketones by [3+2] cycloaddition of azide, followed by 1,5 hydride transfer to the β carbon of the triazoline side chain and fragmentation of the tertiary amino group promoted by coordination of the latter to the Lewis acid. The structure of a triazole product is confirmed by X-ray crystallography.     

Intermolecular stacking of a tetranuclear cyclic Pt(II) complex: NMR characterization and X-ray crystal structure of cis-trans-cis-trans tetra[μ-2,6-diethynyl-4-nitroaniline-bis(tri(p-tolyl)phosphine)platinum(II)]

The synthesis and characterization of a tetranuclear Pt complex, cis-trans-cis-trans tetra[μ-2,6-diethynyl-4-nitroaniline-bis(tri(p-tolyl)phosphine) platinum(II)], namely [L₂Pt-DENA]₄ with L = tri-p-tolylphosphine, is reported. The complex was obtained by the dehydrohalogenative condensation of 2,6-diethynyl-4-nitroaniline (DENA) with cis-[dichlorobis(tri(p-tolyl)phosphine)platinum(II)]. The single crystal structure determination of [L₂Pt-DENA]₄ indicated the formation of a neutral molecular cycle with four alternating platinum units in cis and trans configurations, all bridged with DENA spacers with the presence of solvent (toluene) crystallization molecules. A twisted tetranuclear cyclic feature was identified. The formation of intermolecular stacks of the tetranuclear complex in solution was assessed by means of nuclear Overhauser enhancement spectroscopy (NOESY) and rotating frame Overhauser effect spectroscopy (ROESY) characterizations.     

Photoinduced processes within compact dyads based on triphenylpyridinium-functionalized bipyridyl complexes of ruthenium(II)

As an alternative to conventional charge-separation functional molecular models based on long-range ET within redox cascades, a "compact approach" has been examined. To this end, spacer elements usually inserted between main redox-active units within polyad systems have been removed, allowing extended rigidity but at the expense of enhanced intercomponent electronic communication. The molecular assemblies investigated here are of the P-(theta (1))-A type, where the theta (1) twist angle is related to the degree of conjugation between the photosensitizer (P, of {Ru(bpy)(3)}(2+) type) and the electron-acceptor (A). 4-N- and 4-N-,4'-N-(2,4,6-triphenylpyridinio)-2,2'-bipyridine ligands (A(1)-bpy and A(2)-bpy, respectively) have been synthesized to give complexes with Ru(II), 1-bpy and 2-bpy, respectively. Combined solid-state analysis (X-ray crystallography), solution studies ((1)H NMR, cyclic voltammetry) and computational structural optimization allowed verifying that theta (1) angle approaches 90 degrees within 1-bpy and 2-bpy in solution. Also, anticipated existence of strong intercomponent electronic coupling has been confirmed by investigating electronic absorption properties and electrochemical behavior of the compounds. The capability of 1-bpy and 2-bpy to undergo PET process was evaluated by carrying out their photophysical study (steady state emission and time-resolved spectroscopy at both 293 and 77 K). The conformational dependence of photoinduced processes within P-(theta (1))-A systems has been established by comparing the photophysical properties of 1-bpy (and 2-bpy) with those of an affiliated species reported in the literature, 1-phen. A complementary theoretical analysis (DFT) of the change of spin density distribution within model [1-bpy(theta (1))](-) mono-reduced species as a function of theta (1) has been undertaken and the possibility of conformationally switching emission properties of P was derived.     

Coupling of an indicator-free electrochemical DNA biosensor with polymerase chain reaction for the detection of DNA sequences related to the apolipoprotein E

This paper describes a disposable indicator-free electrochemical DNA biosensor applied to the detection of apolipoprotein E (apoE) sequences in PCR samples. In the indicator-free assays, the duplex formation was detected by measuring the electrochemical signal of the guanine base of nucleic acids. The biosensor format involved the immobilisation of an inosine-modified (guanine-free) probe onto a screen-printed electrode (SPE) transducer and the detection of the duplex formation in connection with the square-wave voltammetric measurement of the oxidation peak of the guanine of the target sequence.The indicator-free scheme has been characterised using 23-mer oligonucleotides as model: parameters affecting the hybridisation assay such as probe immobilisation conditions, hybridisation time, use of hybridisation accelerators were examined and optimised.The analysis of PCR samples (244 bp DNA fragments, obtained by amplification of DNA extracted from human blood) required a further optimisation of the experimental procedure. In particular, a lower steric hyndrance of the probe modified surface was essential to allow an efficient hybridisation of the target DNA fragment. Negative controls have been performed using the PCR blank and amplicons unrelated to the immobilised probe. A 10 min hybridisation time allowed a full characterisation of each sample.     

Exploring the Parallel G-Quadruplex Nucleic Acid World: A Spectroscopic and Computational Investigation on the Binding of the c-myc Oncogene NHE III1 Region by the Phytochemical Polydatin

Trans-polydatin (tPD), the 3-β-D-glucoside of the well-known nutraceutical trans-resveratrol, is a natural polyphenol with documented anti-cancer, anti-inflammatory, cardioprotective, and immunoregulatory effects. Considering the anticancer activity of tPD, in this work, we aimed to explore the binding properties of this natural compound with the G-quadruplex (G4) structure formed by the Pu22 [d(TGAGGGTGGGTAGGGTGGGTAA)] DNA sequence by exploiting CD spectroscopy and molecular docking simulations. Pu22 is a mutated and shorter analog of the G4-forming sequence known as Pu27 located in the promoter of the c-myc oncogene, whose overexpression triggers the metabolic changes responsible for cancer cells transformation. The binding of tPD with the parallel Pu22 G4 was confirmed by CD spectroscopy, which showed significant changes in the CD spectrum of the DNA and a slight thermal stabilization of the G4 structure. To gain a deeper insight into the structural features of the tPD-Pu22 complex, we performed an in silico molecular docking study, which indicated that the interaction of tPD with Pu22 G4 may involve partial end-stacking to the terminal G-quartet and H-bonding interactions between the sugar moiety of the ligand and deoxynucleotides not included in the G-tetrads. Finally, we compared the experimental CD profiles of Pu22 G4 with the corresponding theoretical output obtained using DichroCalc, a web-based server normally used for the prediction of proteins’ CD spectra starting from their “.pdb” file. The results indicated a good agreement between the predicted and the experimental CD spectra in terms of the spectral bands’ profile even if with a slight bathochromic shift in the positive band, suggesting the utility of this predictive tool for G4 DNA CD investigations.     

Polymer-Mercury Coated Screen-Printed Sensors for Electrochemical Stripping Analysis of Heavy Metals

In the perspective of in-field stripping analysis of heavy metals, the use and disposal of toxic mercury solutions (necessary to plate a mercury film on a carbon electrode surface) presents a problem. The aim of this work was the development of mercury coated screen-printed electrodes previously prepared in the lab and ready to use in-field. Thus some commercially available polymers like Nafion®, Eastman Kodak AQ29®, and Methocel® were investigated as mercury entrapping systems for electrochemical stripping analysis of heavy metals. Screen-printed disposable cells with a silver pseudo-reference electrode, a graphite counter electrode, and a graphite working electrode were used. To modify the sensor, the polymer solution was cast onto the carbon working electrode surface. Detection limits of 0.8 and 1 μg/L were obtained for lead and cadmium respectively. Since Methocel® based electrodes showed the best performance, they were used for the analysis of real samples. The results were compared with those obtained using a classical thin mercury film electrode and ICP spectroscopy.

All the experiments reported here were performed in un-deareated solutions as required for in-field analysis.