Exploring the Parallel G-Quadruplex Nucleic Acid World: A Spectroscopic and Computational Investigation on the Binding of the c-myc Oncogene NHE III1 Region by the Phytochemical Polydatin

Trans-polydatin (tPD), the 3-β-D-glucoside of the well-known nutraceutical trans-resveratrol, is a natural polyphenol with documented anti-cancer, anti-inflammatory, cardioprotective, and immunoregulatory effects. Considering the anticancer activity of tPD, in this work, we aimed to explore the binding properties of this natural compound with the G-quadruplex (G4) structure formed by the Pu22 [d(TGAGGGTGGGTAGGGTGGGTAA)] DNA sequence by exploiting CD spectroscopy and molecular docking simulations. Pu22 is a mutated and shorter analog of the G4-forming sequence known as Pu27 located in the promoter of the c-myc oncogene, whose overexpression triggers the metabolic changes responsible for cancer cells transformation. The binding of tPD with the parallel Pu22 G4 was confirmed by CD spectroscopy, which showed significant changes in the CD spectrum of the DNA and a slight thermal stabilization of the G4 structure. To gain a deeper insight into the structural features of the tPD-Pu22 complex, we performed an in silico molecular docking study, which indicated that the interaction of tPD with Pu22 G4 may involve partial end-stacking to the terminal G-quartet and H-bonding interactions between the sugar moiety of the ligand and deoxynucleotides not included in the G-tetrads. Finally, we compared the experimental CD profiles of Pu22 G4 with the corresponding theoretical output obtained using DichroCalc, a web-based server normally used for the prediction of proteins’ CD spectra starting from their “.pdb” file. The results indicated a good agreement between the predicted and the experimental CD spectra in terms of the spectral bands’ profile even if with a slight bathochromic shift in the positive band, suggesting the utility of this predictive tool for G4 DNA CD investigations.     

Iridoid glycosides and polyphenolic compounds from Teucrium chamaedrys L.

In this work, the phytochemical analysis of Teucrium chamaedrys L. collected in Italy was reported. Eight compounds were isolated and identified by means of classical column chromatography and spectroscopic techniques, such as NMR and MS. In detail, these compounds were: verbascoside (1), forsythoside b (2), samioside (3), alyssonoside (4), harpagide (5), 8-O-acetyl-harpagide (6), cirsiliol (7) and β-arbutin (8). The presence of these compounds, in particular iridoids and phenyl-ethanoid glycosides, has a chemotaxonomic relevance and results to be in perfect accordance with the current botanical classification of the species. In addition, it provides a phytochemical rationale for the use of this particular plant in the ethno-pharmacological field. Conversely, it is worth of mention the absence of potentially toxic components, unlike to what observed in other species of the genus which can no longer be used for ethno-medicinal purposes.     

First-principle molecular dynamics of the Berry pseudorotation: insights on 19F NMR in SF4

First-principles [density-functional theory (DFT)] molecular-dynamic simulations of the Berry pseudorotation mechanism in SF4 were performed using the atom-centered density-matrix propagation method. The reaction was monitored by following the chemical shieldings of the fluorine atoms, computed on snapshots along the trajectories. In particular we compared the results obtained using a standard functional based on the generalized gradient approximation with those issuing from its hybrid Hartree-Fock-DFT counterpart using a number of basis sets. Our results show that both the basis set and the functional choice rule the quality of the molecular properties monitored as well as the trajectory over the potential-energy surface.     

Solution and Solid‐State Studies on the Halide Binding Affinity of Perfluorophenyl‐Armed Uranyl–Salophen Receptors Enhanced by Anion–π Interactions

The enhancement of the binding between halide anions and a Lewis acidic uranyl–salophen receptor has been achieved by the introduction of pendant electron‐deficient arene units into the receptor skeleton. The association and the occurrence of the elusive anion–π interaction with halide anions (as tetrabutylammonium salts) have been demonstrated in solution and in the solid state, providing unambiguous evidence on the interplay of the concerted interactions responsible for the anion binding.     

Determination of Anticholinesterase Activity for Pesticides Monitoring Using a Thiocholine Sensor

Abstract

An acetylthiocholine sensor based on a disposable screen-printed carbon electrode has been assembled for measuring organophosphorus and carbamate pesticides in river water samples through the degree of inhibition of the enzyme acetylcholinesterase (AChE). The carbon working electrode surface was modified by deposition of a mediator, tetracyanoquinodimethane (TCNQ), and Nafion. Acetylcholinesterase catalyses the cleavage of acetylthiocholine to thiocholine, which is measured by differential pulse voltammetry and directly related to the enzyme activity. The scan speed, the pulse amplitude of the differential pulse voltammetry and several parameters in the procedure were optimised. An inhibition calibration curve was obtained using carbofuran. The method was also applied to water samples, showing its suitability as a rapid screening assay (15 min per test) for anticholinesterase activity detection.     

Colorants and oils in Roman make-ups–an eye witness account

Archaeological cosmetics, as well as revealing ancient knowledge, contain a complex mixture of very different organic and inorganic components with diverse properties. Most information on the preparation of ancient cosmetics comes from classical texts. However, although analysis of products contained in archaeological objects has recently identified some ingredients, there is still little known about how the cosmetics were prepared.Using a multi-analytical approach, we studied the chemical composition of two Roman pink make-ups that were preserved on the surface of a Roman bronze cosmetic tool and in a glass unguentarium. The results revealed that both make-ups were colored by madder lake but prepared in two different ways and with two completely different matrices (i.e. scented oils in the first case and gypsum in the second) highlighting that the make-ups had been prepared thoroughly, the ingredients carefully selected and their properties and possibilities for good cosmetic use had been understood.     

Convergent synthesis of mosloflavone, negletein and baicalein from crysin

An expeditious synthesis of three polyoxygenated flavones: mosloflavone, negletein and baicalein, starting from crysin, an easily available flavone, by a bromination/methoxylation procedure is reported. The convergent synthesis exploits a base induced Wesley-Moser type rearrangement.     

Flavonoids: A Myth or a Reality for Cancer Therapy?

Nutraceuticals are biologically active molecules present in foods; they can have beneficial effects on health, but they are not available in large enough quantities to perform this function. Plant metabolites, such as polyphenols, are widely diffused in the plant kingdom, where they play fundamental roles in plant development and interactions with the environment. Among these, flavonoids are of particular interest as they have significant effects on human health. In vitro and/or in vivo studies described flavonoids as essential nutrients for preventing several diseases. They display broad and promising bioactivities to fight cancer, inflammation, bacterial infections, as well as to reduce the severity of neurodegenerative and cardiovascular diseases or diabetes. Therefore, it is not surprising that interest in flavonoids has sharply increased in recent years. More than 23,000 scientific publications on flavonoids have described the potential anticancer activity of these natural molecules in the last decade. Studies, in vitro and in vivo, show that flavonoids exhibit anticancer properties, and many epidemiological studies confirm that dietary intake of flavonoids leads to a reduced risk of cancer. This review provides a glimpse of the mechanisms of action of flavonoids on cancer cells.