Exploring the Parallel G-Quadruplex Nucleic Acid World: A Spectroscopic and Computational Investigation on the Binding of the c-myc Oncogene NHE III1 Region by the Phytochemical Polydatin

Trans-polydatin (tPD), the 3-β-D-glucoside of the well-known nutraceutical trans-resveratrol, is a natural polyphenol with documented anti-cancer, anti-inflammatory, cardioprotective, and immunoregulatory effects. Considering the anticancer activity of tPD, in this work, we aimed to explore the binding properties of this natural compound with the G-quadruplex (G4) structure formed by the Pu22 [d(TGAGGGTGGGTAGGGTGGGTAA)] DNA sequence by exploiting CD spectroscopy and molecular docking simulations. Pu22 is a mutated and shorter analog of the G4-forming sequence known as Pu27 located in the promoter of the c-myc oncogene, whose overexpression triggers the metabolic changes responsible for cancer cells transformation. The binding of tPD with the parallel Pu22 G4 was confirmed by CD spectroscopy, which showed significant changes in the CD spectrum of the DNA and a slight thermal stabilization of the G4 structure. To gain a deeper insight into the structural features of the tPD-Pu22 complex, we performed an in silico molecular docking study, which indicated that the interaction of tPD with Pu22 G4 may involve partial end-stacking to the terminal G-quartet and H-bonding interactions between the sugar moiety of the ligand and deoxynucleotides not included in the G-tetrads. Finally, we compared the experimental CD profiles of Pu22 G4 with the corresponding theoretical output obtained using DichroCalc, a web-based server normally used for the prediction of proteins’ CD spectra starting from their “.pdb” file. The results indicated a good agreement between the predicted and the experimental CD spectra in terms of the spectral bands’ profile even if with a slight bathochromic shift in the positive band, suggesting the utility of this predictive tool for G4 DNA CD investigations.     

Modeling the interaction of solitary waves and semi-circular breakwaters by using unsteady reynolds equations

A vertical 2 -D numerical wave model was developed based on unsteady Reynolds equations. In this model, the k-epsilon models were used to close the Reynolds equations, and volume of fluid( VOF) method was used to reconstruct the free surface. The model was verified by experimental data. Then the model was used to simulate solitary wave interaction with submerged, alternative submerged and emerged semi-circular breakwaters. The process of velocity field, pressure field and the wave surface near the breakwaters was obtained. It is found that when the semi-circular breakwater is submerged, a large vortex will be generated at the bottom of the lee side wall of the breakwater ; when the still water depth is equal to the radius of the semi-circular breakwater, a pair of large vortices will be generated near the shoreward wall of the semi-circular breakwater due to wave impacting, but the velocity near the bottom of the lee side wall of the breakwater is always relatively small. When the semi-circular breakwater is emerged, and solitary wave cannot overtop it, the solitary wave surface will run up and down secondarily during reflecting from the breakwater. It can be further used to estate the diffusing and transportation of the contamination and transportation of suspended sediment.     

Highly reduced iron-doped lithium niobate for optoelectronic tweezers

We investigate the applicability of highly reduced lithium niobate samples doped with iron for the use as optoelectronic tweezers. Increasing the reduction degree of Fe-doped lithium niobate is well known to increase the photoconductivity and reduce the writing time of internal space-charge fields. Based on our measurements of the photorefractive properties, we determine the optimal conditions for dielectrophoretic trapping and present the application of Fe-doped lithium niobate as optoelectronic tweezers. For higher reduction degrees, an unexpected decrease in the photovoltaic current density and the saturation space-charge field is reported.     

Meshing Requirements for Tidal Modeling in the Western North Atlantic

This paper presents an a posteriori approach to unstructured mesh generation via a localized truncation error analysis and applies it to the Western North Atlantic Tidal (WNAT) model domain. The WNAT model domain encompasses the Gulf of Mexico, the Caribbean Sea, and the North Atlantic Ocean east to the 60°W Meridian. Herein, we pay particular attention to the area surrounding the Bahamas.

A bathymetric data set with fine resolution is employed in seven separate linear, harmonic simulations of shallow water tidal flow for seven different tidal-forcing constituents. Each set of simulation results is used to perform a truncation error analysis of a linear, harmonic form of the depth-averaged momentum equations for each of the seven different tidal-forcing frequencies. Truncation error is then driven to a more uniform, domain-wide value by solving for local node spacing requirements. The process is built upon successful research aiming to produce unstructured grids for large-scale domains that can be used in the accurate and efficient modeling of shallow water flow. The methodology described herein can also be transferred to other modeling applications.     

A facile protocol for the preparation of 5-alkylidene and 5-imino substituted hydantoins from N,N′-disubstituted parabanic acids

A convenient procedure for the preparation of various substituted (thio)hydantoins is described. The method is based on Wittig and aza-Wittig reactions of parabanic acids with phosphonium ylides. The reactions occurred both regio- and stereo-selectively.     

Synthesis and some properties of a new compound in the Al–Sb–V–O system

A new compound in the Al?CSb?CV?CO system of the composition AlSbVO₆ was successfully synthesized by a solid-state reaction and characterized by powder XRD diffraction. The structural and thermal properties of AlSbVO₆ were investigated. The infra-red spectrum of the new phase is presented.     

(E)-2-Benzylidenebenzocyclanones: Part VII. Investigation of the conjugation reaction of two cytotoxic cyclic chalcone analogues with glutathione: an HPLC–MS study

Abstract  

The non-enzyme-catalyzed reaction of reduced glutathione (GSH) with two tumor cell cytotoxic cyclic chalcone analogues was investigated by reversed-phase high-performance liquid chromatography (RP-HPLC). HPLC analysis of the reaction mixtures indicated the formation of two diastereomeric chalcone–GSH adducts in each case, whose structural assignments were supported by MALDI-TOF-MS and HPLC–MS with electrospray ionization (ESI) measurements. Such reactivity accounts for the previously observed effect of the two cyclic chalcone analogues on the in vivo cellular thiol level of Jurkat T cells.     

Selfadjoint extensions of a singular differential operator

In this work, firstly in the Hilbert space of vector-functions all selfadjoint extensions of the minimal operator generated by linear singular symmetric differential expression with a selfadjoint operator coefficient A in any Hilbert space H, are described in terms of boundary values. Later structure of the spectrum of these extensions is investigated.