Excited-state proton transfer in N-methyl-6-hydroxyquinolinium salts: solvent and temperature effects

The excited-state proton transfer (ESPT) reaction of the "super"photoacid N-methyl-6-hydroxyquinolinium (MHQ) was studied using both fluorescence upconversion and time-correlated single photon counting (TCSPC) techniques. The ultrafast ESPT kinetics were investigated in various alcohols and water and determined to be solvent-controlled. The ESPT temperature dependence of MHQ was also studied in various alcohols and compared to that observed for another "super"photoacid, 5,8-dicyano-2-naphthol (DCN2). A full set of kinetic and thermodynamic parameters describing the ESPT was obtained. The protolytic photodissociation rate constant for MHQ was higher than that for DCN2, while the ESPT activation energies of MHQ were smaller. These findings are attributed to the approximately 3 orders of magnitude differences in excited-state acidities of MHQ and DCN2.     

Determination of the plasticizer N-butylbenzenesulfonamide and the pharmaceutical Ibuprofen in wastewater using solid phase microextraction (SPME)

A rapid, inexpensive and solvent-free method for the simultaneous determination of the polyamide plasticizer N-butylbenzenesulfonamide (NBBS) and the widely used pharmaceutical Ibuprofen by solid phase microextraction (SPME) combined with gas chromatography/mass spectrometry (GC/MSD) in wastewater samples was developed. Besides the optimized analytical conditions, results of investigations with varying analytical parameters are reported. Problems, which may occur during the analytical procedure (e.g. salt deposits, adsorption phenomena, carry-over), are discussed. For the determination of Ibuprofen, it is important to carry out the extraction under acidic conditions with sufficiently buffered samples; the GC/MSD system must be very clean and well maintained. SPME allows an extraction of Ibuprofen without derivatization of its carboxylic group. For quantification in complex matrices, the standard addition technique is necessary. Limit of detection and limit of determination are 0.1 μg/L for both analytes. NBBS and Ibuprofen were detected in several raw and treated wastewater samples from municipal wastewater treatment plants in the range from < 0.1 to 3.5 μg/L. Received: 13 March 1998 / Revised: 16 June 1998 / Accepted: 19 June 1998     

Putative DNA quadruplex formation within the human c-kit oncogene

The DNA sequence, d(AGGGAGGGCGCTGGGAGGAGGG), occurs within the promoter region of the c-kit oncogene. We show here, using a combination of NMR, circular dichroism, and melting temperature measurements, that this sequence forms a four-stranded quadruplex structure under physiological conditions. Variations in the sequences that intervene between the guanine tracts have been examined, and surprisingly, none of these modified sequences forms a quadruplex arrangement under these conditions. This suggests that the occurrence of quadruplex-forming sequences within the human and other genomes is less than was hitherto expected. The c-kit quadruplex may be a new target for therapeutic intervention in cancers where there is elevated expression of the c-kit gene.     

Effect of temperature on excited-state proton tunneling in wt-green fluorescent protein

Steady-state emission and time-correlated single-photon counting (TCSPC) are used to measure the temperature dependence of the proton-transfer rate of wt-GFP in H2O and D2O. As the temperature decreases, the proton-transfer rate from the protonated form slows down. At about 80 K, the rate is about 10-fold slower than the rate at room temperature. At lower temperatures of 70 K down to 13 K (the lowest temperature studied), the rate of proton transfer is almost temperature independent. We explain the temperature dependence of the proton-transfer rate by an intermolecular vibration assisted tunneling mechanism. We attribute the specific intermolecular vibration to the oscillation of two oxygen atoms: the chromophore's phenol ring and the nearby water molecule. The kinetic isotope effect is about 5 and is almost temperature independent.     

Origin of the nonexponential dynamics of excited-state proton transfer in wt-green fluorescent protein

We used an inhomogeneous excited-state proton-transfer kinetics model to explain the origin of the non-exponential time-resolved emission of the A-band of wt-green fluorescence protein. The calculated fit is rather good for both H 2O and D 2O samples in a wide temperature range of 80-229 K. We attribute the inhomogeneous kinetics to the distance dependence of the excited-state proton-transfer rate between the proton donor (the hydroxyl group of the chromophore) and the oxygen of a nearby water molecule.     

Four-stranded nucleic acids: structure, function and targeting of G-quadruplexes

There are many structures that can be adopted by nucleic acids other than the famous Watson-Crick duplex form. This tutorial review describes the guanine rich G-quadruplex structure, highlighting the chemical interactions governing its formation, and the topological variants that exist. The methods that are used to study G-quadruplex structures are described, with examples of the information that may be derived from these different methods. Next, the proposed biological functions of G-quadruplexes are discussed, highlighting especially their presence in telomeric regions and gene promoters. G-quadruplex structures are the subject of considerable interest for the development of small-molecule ligands, and are also the targets of a wide variety of natural proteins.     

Zur Sylowstruktur auflösbarer Gruppen. II

Ohne ZusammenfassungDer Inhalt der vorliegenden Note ist unabhängig von einer früher erschienenen Arbeit gleichen Titels (Huppert [3]).     

Excited-state proton transfer in methanol-doped ice in the presence of KF

Steady-state and time-resolved emission techniques were employed to study the photoprotolytic cycle of an excited photoacid in ice in the presence of a low concentration of a weak base-like F(-). In previous studies we found that the photoprotolytic cycle in methanol-doped ice (1% mol fraction) is too slow to be observed at temperatures below 190 K. In this study we found that at temperatures below 240 K an additional proton-transfer process occurs in ice doped with 10 mM KF. We attributed this reaction to the creation of a mobile L-defect by F(-) ions. We used a diffusion-assisted reaction model, based on the Debye-Smoluchowski equation, to account for the direct reaction of the L-defect with the excited photoacid at temperatures below T < 240 K. Below 160 K the spectroscopic properties as well as the photoprotolytic cycle change dramatically. We propose that below 160 K the sample enters a new phase. The excited-state proton-transfer (ESPT) process was observed and followed down to a liquid nitrogen temperature of approximately 78 K. In the low-temperature phase the ESPT rate is almost twice as much as at 180 K and the temperature dependence of the rate is very small. The kinetic isotope effect of the ESPT at the low-temperature phase is small of about 1.3.     

Ultrafast excited-state intermolecular proton transfer of cyanine fluorochrome dyes

Steady-state and time-resolved emission spectroscopy techniques were employed to study the excited-state proton transfer (ESPT) to water and D(2)O from QCy7, a recently synthesized near-infrared (NIR)-emissive dye with a fluorescence band maximum at 700 nm. We found that the ESPT rate constant, k(PT), of QCy7 excited from its protonated form, ROH, is ~1.5 × 10(12) s(-1). This is the highest ever reported value in the literature thus far, and it is comparable to the reciprocal of the longest solvation dynamics time component in water, τ(S) = 0.8 ps. We found a kinetic isotope effect (KIE) on the ESPT rate of ~1.7. This value is lower than that of weaker photoacids, which usually have KIE value of ~3, but comparable to the KIE on proton diffusion in water of ~1.45, for which the average time of proton transfer between adjacent water molecules is similar to that of QCy7.