Alignment of molecules in pulsed resonant laser fields

We investigate by numerical simulations the dynamics of alignment of linear molecules in resonant pulsed laser fields and its dependence on pulse length, field strength, and molecular parameters. We propose an analytical short-time approximation for the time-dependent wave packets. We provide a theoretical basis for the occurrence of saturation in the rotational pumping. We present a formula to predict the time at which the maximum alignment occurs. We discuss the magnitude of the laser-induced alignment and we relate it to a theoretical upper limit.     

On elliptic equations with an axial symmetry

Sunto Si considera l'equazione (*) au_xx+2bu_xy+cu_yy+(d/y)u_y=f dove a, b, c, d L, d > 0, f L². Supponendo che (*) sia uniformemente eliittica e che l'oscillazione del quoziente d/a verifichi una resirizione vicino all'asse della x, si provano stime a priori e un teorema di esistenza per soluzioni W^2,2 di un problema di Dirichlet relativo all'equazione (*).

---

---

Work supported by the Istituto di Analisi Globale e Applicazioni.     

GO-SWCNT Buckypapers as an Enhanced Technology for Water Decontamination from Lead

Water decontamination is an important challenge resulting from the incorrect disposal of heavy metal waste into the environment. Among the different available techniques (e.g., filtration, coagulation, precipitation, and ion-exchange), adsorption is considered the cheapest and most effective procedure for the removal of water pollutants. In the last years, several materials have been tested for the removal of heavy metals from water, including metal-organic frameworks (MOFs), single-walled carbon nanotubes (SWCNTs), and graphene oxide (GO). Nevertheless, their powder consistency, which makes the recovery and reuse after adsorption difficult, is the main drawback for these materials. More recently, SWCNT buckypapers (SWCNT BPs) have been proposed as self-standing porous membranes for filtration and adsorption processes. In this paper, the adsorption capacity and selectivity of Pb²⁺ (both from neat solutions and in the presence of other interferents) by SWCNT BPs were evaluated as a function of the increasing amount of GO used in their preparation (GO-SWCNT buckypapers). The highest adsorption capacity, 479 ± 25 mg g⁻¹, achieved for GO-SWCNT buckypapers with 75 wt.% of graphene oxide confirmed the effective application of such materials for cheap and fast water decontamination from lead.     

Exploring the Parallel G-Quadruplex Nucleic Acid World: A Spectroscopic and Computational Investigation on the Binding of the c-myc Oncogene NHE III1 Region by the Phytochemical Polydatin

Trans-polydatin (tPD), the 3-β-D-glucoside of the well-known nutraceutical trans-resveratrol, is a natural polyphenol with documented anti-cancer, anti-inflammatory, cardioprotective, and immunoregulatory effects. Considering the anticancer activity of tPD, in this work, we aimed to explore the binding properties of this natural compound with the G-quadruplex (G4) structure formed by the Pu22 [d(TGAGGGTGGGTAGGGTGGGTAA)] DNA sequence by exploiting CD spectroscopy and molecular docking simulations. Pu22 is a mutated and shorter analog of the G4-forming sequence known as Pu27 located in the promoter of the c-myc oncogene, whose overexpression triggers the metabolic changes responsible for cancer cells transformation. The binding of tPD with the parallel Pu22 G4 was confirmed by CD spectroscopy, which showed significant changes in the CD spectrum of the DNA and a slight thermal stabilization of the G4 structure. To gain a deeper insight into the structural features of the tPD-Pu22 complex, we performed an in silico molecular docking study, which indicated that the interaction of tPD with Pu22 G4 may involve partial end-stacking to the terminal G-quartet and H-bonding interactions between the sugar moiety of the ligand and deoxynucleotides not included in the G-tetrads. Finally, we compared the experimental CD profiles of Pu22 G4 with the corresponding theoretical output obtained using DichroCalc, a web-based server normally used for the prediction of proteins’ CD spectra starting from their “.pdb” file. The results indicated a good agreement between the predicted and the experimental CD spectra in terms of the spectral bands’ profile even if with a slight bathochromic shift in the positive band, suggesting the utility of this predictive tool for G4 DNA CD investigations.     

Surface anchoring,polarization fields and memory states in polymer dispersed liquid crystals

We have investigated the formation and development of memory states in polymer dispersed liquid crystals induced by the application of a strong electric field. Both the optical transmittance and polarization field have been followed as functions of time. We have been able to distinguish between the contributions to the memory states arising from the surface anchoring of the liquid crystal at the droplet interface and from the electrical reorientation of the mesogenic molecules. The dependence of both residual transmittance and polarization field on temperature is reported and a simple model is proposed.     

Highly reduced iron-doped lithium niobate for optoelectronic tweezers

We investigate the applicability of highly reduced lithium niobate samples doped with iron for the use as optoelectronic tweezers. Increasing the reduction degree of Fe-doped lithium niobate is well known to increase the photoconductivity and reduce the writing time of internal space-charge fields. Based on our measurements of the photorefractive properties, we determine the optimal conditions for dielectrophoretic trapping and present the application of Fe-doped lithium niobate as optoelectronic tweezers. For higher reduction degrees, an unexpected decrease in the photovoltaic current density and the saturation space-charge field is reported.     

A New Approach to The Synthesis of Enantiomerically Pure 4-Deoxy Sugars

In a recent paper² we have reported the design and synthesis of 3-C-lithiated 5,6-dihydro-1,4-dithiin-2-yl[(4-methoxybenzyl)oxy]methane (1) which can be utilized as an allylic alcohol anion equivalent and leads to three-carbon elongations of various electrophiles by introduction of a fully protected hydroxypropenyl moiety. The latter contains a double bond, which can be unravelled to the cis configuration by diastereoselective removal³ of the dimethylene-disulfur bridge, as well as a protected primary hydroxyl group that, depending on the deprotection conditions used (DDQ/NaBH₄ or DDQ), may either lead to the free allylic alcohol or to an α,β-unsaturated aldehyde.     

A corresponding states principle-based equation for the surface tension of Alkenes

This study presents a new formula for the surface tension prediction of alkenes. As a first step, an analysis of the available data of the experimental surface tension data for alkenes was performed. The experimental data were collected, after a careful literature survey, for the following pure fluids: propene, 1-hexene, 1-heptene, 1-octene, 1-decene, 1-tetradecene, and 1-pentadecene. Then, the experimental data were regressed with the most reliable semi-empirical correlating methods based on the corresponding state theory existing in the literature. As a final step, an analysis of the available data of the experimental surface tension data for alkenes was performed starting from the two recently proposed equations for the prediction of the surface tension of refrigerants based on the corresponding states principle. To minimize the deviation between the predicted data and the experimental data and to find the optimal equation coefficients for experimental data regression, a (μ + λ)-evolution strategy was adopted. The analysis showed that the equation that gave the best results for the prediction of the surface tension of alkenes was the one with a very limited number of parameters. The finally proposed equation is very simple and gives a noticeable improvement with respect to the existing equations. It is based on the corresponding state principle, containing the acentric factor, the critical temperature, and pressure.     

CHIRAL VARIANTS OF ARYLALKYL SULFUR REAGENTS. (R)-CAMPHOR KETIMINES OF OGIOVANNA AMINOTHIOETHERS AND OXIDES

Abstract

Ketimines la-d derived from ortho-aminosubstituted phenylthioethers were prepared in order to determine the degree of chirality transfer from the chiral auxiliary to the sulfur atom in the formation of the sulfoxide or to the α-carbon atom in the reaction of the anion with alkyl halides or benzaldehyde. Oxidation to the sulfoxide occurred with little or no asymmetric induction. The crystalline benzyl sulfone 4c was deprotonated by alkyllithium or Grignard reagents and reacted with alkyl halides and benzaldehyde, in all cases with little to fair transfer of chirality. The major diastereoisomer from methylation of the anion of 4c with methyl iodide, was isolated, and afforded the enantiomerically pure amine 5 after removal of the chiral auxiliary. An X-ray structure determination of 4d allowed the assignment of the absolute configuration of the asymmetric carbon and revealed that the conformation of the ketimine in the crystal state is not homogeneous.