Micelles based on gold-glycopolymer complexes as new chemotherapy drug delivery agents

Polymeric versions of deacetylated auranofin, a gold complex with a sugar ligand, were prepared by post-modifying RAFT glycopolymers. Micellisation of a block copolymer containing pendant Au(I) units produced nanoparticles with an increased anti-proliferative effect against OVCAR-3 human ovarian carcinoma cells.     

On improvement of PIV image interrogation near stationary interfaces

In this paper the problem posed by interfaces when present in PIV measurements is addressed. Different image pre-processing, processing and post-processing methodologies with the intention to minimize the interface effects are discussed and assessed using Monte Carlo simulations. Image treatment prior to the correlation process is shown to be incapable of fully removing the effects of the intensity pedestal across the object edge. The inherent assumption of periodicity in the signal causes the FFT-based correlation technique to perform the worst when the correlation window contains a signal truncation. Instead, an extended version of the masking technique introduced by Ronneberger et al. (Proceedings of the 9th international symposium on applications of laser techniques to fluid mechanics, Lisbon, 1998) is able to minimize the interface-correlation, resolving only the particle displacement peak. Once the displacement vector is obtained, the geometric center of the interrogation area is not the correct placement. Instead, the centre of mass position allows an unbiased representation of the wall flow (Usera et al. in Proceedings of the 12th international symposium on applications of laser techniques to fluid mechanics, Lisbon, 2004). The aforementioned concepts have been implemented in an adaptive interrogation methodology (Theunissen et al. in Meas Sci Technol 18:275–287, 2007) where additionally non-isotropic resolution and re-orientation of the correlation windows is applied near the interface, maximizing the wall-normal spatial resolution. The increase in resolution and robustness are demonstrated by application to a set of experimental images of a flat-plate, subsonic, turbulent boundary layer and a hypersonic flow over a double compression ramp.     

Exploring the Parallel G-Quadruplex Nucleic Acid World: A Spectroscopic and Computational Investigation on the Binding of the c-myc Oncogene NHE III1 Region by the Phytochemical Polydatin

Trans-polydatin (tPD), the 3-β-D-glucoside of the well-known nutraceutical trans-resveratrol, is a natural polyphenol with documented anti-cancer, anti-inflammatory, cardioprotective, and immunoregulatory effects. Considering the anticancer activity of tPD, in this work, we aimed to explore the binding properties of this natural compound with the G-quadruplex (G4) structure formed by the Pu22 [d(TGAGGGTGGGTAGGGTGGGTAA)] DNA sequence by exploiting CD spectroscopy and molecular docking simulations. Pu22 is a mutated and shorter analog of the G4-forming sequence known as Pu27 located in the promoter of the c-myc oncogene, whose overexpression triggers the metabolic changes responsible for cancer cells transformation. The binding of tPD with the parallel Pu22 G4 was confirmed by CD spectroscopy, which showed significant changes in the CD spectrum of the DNA and a slight thermal stabilization of the G4 structure. To gain a deeper insight into the structural features of the tPD-Pu22 complex, we performed an in silico molecular docking study, which indicated that the interaction of tPD with Pu22 G4 may involve partial end-stacking to the terminal G-quartet and H-bonding interactions between the sugar moiety of the ligand and deoxynucleotides not included in the G-tetrads. Finally, we compared the experimental CD profiles of Pu22 G4 with the corresponding theoretical output obtained using DichroCalc, a web-based server normally used for the prediction of proteins’ CD spectra starting from their “.pdb” file. The results indicated a good agreement between the predicted and the experimental CD spectra in terms of the spectral bands’ profile even if with a slight bathochromic shift in the positive band, suggesting the utility of this predictive tool for G4 DNA CD investigations.     

PCB-126 effects on aryl hydrocarbon receptor,ubiquitin and p53 expression levels in a fish product (Sparus aurata L.)

The aim of the present study is to determine if Ahr ligands as PCB-126, a dioxin-like, might contribute to inhibition of the tumour suppressor p53 by promoting its degradation through proteasome-ubiquitin system (UPS). The findings show, in the presence of PCB-126, a significant increase in p53 immunoreactivity in fish compared to the control. Subsequently, there is a decrease in p53 immunoreactivity at 24 h which is maintained even at 72 h. There is also a slight decrease in ubiquitin immunoreactivity to 12 h compared to the control and a marked decrease to 24 and 72 h. It’s very important to underline as in this study we demonstrate a marked decrease in ubiquitin and p53 immunoreactivity at 24 and 72 h. Our result emphasise the need to deeply the role of this receptor in UPS regulation as potential therapeutic target for cancer treatment.     

Synthesis and Structure of New Cobalt–Carbonyl Complexes Containing Tellurium Atoms

Co₂(CO)₈ and Te₂O react to form the well known Co₄(CO)₁₀Te₂, Co₄(CO)₁₁Te₂ complexes and the two new cluster complexes CCo₆(CO)₁₂Te₂(1), and CCo₆(CO)₁₀Te₂(Te₃) (2). The structures of 1 and 2 were determined by X-ray analysis, together with the triphenylphosphine derivative of 1, CCo₆(CO)₁₁(PPh₃)Te₂(3), which was analyzed to clarify the disordered structure of the parent compound. Complex 1 is formed by a prismatic cluster of cobalt atoms with a carbon embedded in the cage; two tellurium atoms cap the triangular faces of the prism and each cobalt atom links two terminal carbonyl groups. The complex 2 has a similar prismatic cage CCo₆; two ₄-Te atoms cap two rectangular faces of the prism, while other two Te atoms bridge two edges of the triangular faces and are linked each other through a third Te atom. Electron counting gives for complex 2 92 electrons: the presence of two long Co–Co distances suggests that the two excess electrons are located on Co–Co antibonding orbitals. Crystal data for 1, space group C2/c, a = 12.845(2) Å, b = 13.449(2) Å, c = 13.246(2) Å, = 91.95(2)°, Z = 4, R = 0.097 for 2555 reflections; for 2, space group Pnna, a = 17.219(5) Å, b= 14.969(6) Å, c = 9.178(4) Å, Z = 4,R = 0.037 for 3103 reflections; for 3, space group P2₁/c, a = 9.288(2) Å, b = 14.920(6) Å, c = 26.300(9) Å, = 99.99(2)°, Z = 4, R = 0.037 for 4300 reflections. The vibrational analysis of the complex 1 was performed and most of the (CO), (₆C–Co), (Co–Co) and (Co–Co) modes were assigned. The (Co–Te) modes were interpreted on the basis of the intermolecular coupling, due to the close contact between neighboring clusters in one distinct direction in the crystal.     

Development of a tandem thin-layer chromatography-high-performance liquid chromatography method for the identification and determination of corticosteroids in cosmetic products

A solid-phase extraction clean-up and and a liquid chromatographic method with ultraviolet detection were developed for the analysis of 51 corticosteroids in cosmetic samples in order to screen commercial samples for the presence of undeclared synthetic corticosteroids. A thin-layer chromatographic analysis was carried out on silica gel plates, using different eluants and detection reagents. When such a preliminary chromatographic separation gave some indications about the presence of steroid compounds, the methanol extracts from real samples were applied to a solid-phase extraction C₁₈ cartridge, and the analytes eluted with ethyl ether. The high-performance liquid chromatographic separation was then carried out for the identification and determination of the analytes using a Purospher RP-18 column, an isocratic or a gradient elution with a mixture acetonitrile-water and a photodiode-array detector. The accuracy of the method was determined by spiking experiments on home-made cosmetic samples. The analytical recoveries were satisfactory.     

Evaluation of enzymatic kinetic parameters by thin-layer chromatography with radiometric detection

A radiochromatographic method is described for evaluating K_m and v_max based on a simple modification of the integrated Michaelis-Menten equation. Experimental points are ritted directly to this equation be an iterative technique, the validity of which is tested on simulated experimental data. Results for lysine, ornithine, and glutamic acid decarboxylases are reported.     

Chemistry of μ-hydridobis[pentacarbonylchromium(0)] species. Part III. Redox reactions with mercury(II) compounds and iodine

Summary [Cr₂(CO)₁₀(-H)]^– undergoes ready hydride substitution on reaction with HgX₂ (X = Cl, Br, I or SCN) or with iodine in acetone, yielding [Cr₂(CO)₁₀(-X)]^– complex species which can be converted quantitatively into [Cr(CO)₅X]^– anions by reactions conducted in the presence of an excess of X^–.LCr(CO)₅ and (L-L)Cr(CO)₄ complexes (L = pyridine; L-L = 1,10-phenanthroline or 2,2-bipyridine) are easily prepared by reactions performed in the presence of the L or L-L ligand, respectively.     

Design of a dual aptamer-based recognition strategy for human matrix metalloproteinase 9 protein by piezoelectric biosensors

MMP-9, human matrix metalloproteinase 9, belongs to the family of zinc-dependent peptide-bond hydrolases and is involved in the degradation of the extracellular matrix (ECM). In clinics, it is well known that elevated MMP-9 serum levels are associated with cardiovascular dysfunctions, several aspects of the physiology and pathology of the central nervous system, neuropsychiatric disorders and degenerative diseases related to brain tumors, and excitotoxic/neuroinflammatory processes. Due to the large interest of diagnostics in this protein, efforts to set up sensitive methods to detect MMP-9 for early diagnosis of a number of metabolic alterations are rapidly increasing. In this panorama, biosensors could play a key role; therefore we explored for the first time the development of an aptamer-based piezoelectric biosensor for a sensitive, label free, and real time detection of MMP-9. The detecting strategy involved two different aptamers in a sandwich-like approach able to detect down to 100 pg mL⁻¹ (1.2 pM) of MMP-9 as detection limit in standard solution. As proof of principle, commercial serum was investigated in terms of possible interferents, their identification and role in MMP-9 detection. The estimated detection limit for MMP-9 is about 560 pg mL⁻¹ (6.8 pM) in untreated serum.     

HPLC‐ESI‐MS analysis of oral human fluids reveals that gingival crevicular fluid is the main source of oral thymosins β4 and β10

Thymosin β₄ (Tβ₄), its sulfoxide, and thymosin β₁₀ (Tβ₁₀) were detected in human saliva and identified by different strategies based on RP HPLC coupled to electrospray multidimensional IT MS. Tβ₄ was almost always detected in whole saliva, its sulfoxide sporadically, Tβ₁₀ rarely. Tβ₄ was undetectable in parotid saliva and less concentrated in submandibular/sublingual saliva than in whole saliva. Analysis of gingival crevicular fluid revealed high relative amounts of Tβ₄, Tβ₄ sulfoxide, and Tβ₁₀ in all the samples. Tβ₄ mean concentration was 200 times higher in crevicular fluid (20 μmol/L, N = 9) than in whole saliva (0.1 μmol/L, N = 9). Crevicular fluid concentration of Tβ₄ (ca. 5% represented by its sulfoxide) and β₁₀ significantly correlated (r = 0.856; N = 9), and their ratio was about 5. A significant correlation was also observed between Tβ₄ concentrations in whole saliva and gingival crevicular fluid (r = 0.738; N = 9). Immunohistochemical analysis of the major salivary glands showed that immunoreactivity for Tβ₄ is restricted to ductal cells, with minor degree of focal positivity in some acinar cells. On the whole, results indicate that gingival sulcus is a main, although not the sole, source for oral Tβ₄ and Tβ₁₀.