Structural assignment of organotin hydrides containing the oxazoline ligand

A series of triorganotin hydrides and diorganotin dihydrides containing the optically active 2-(4-isopropyl-2-oxazolinyl)-5-phenyl ligand have been characterized by means of the multinuclear low-temperature NMR investigations, the results of which are discussed. In the corresponding organotin hydrides values of the ¹J(¹H-^117/119Sn) couplings appeared to be temperature dependent, supporting an axial/equatorial position of the hydrogen attached to the tin.     

2,2,5,5-tetramethylpyrrolidin-3-one-1-sulfinyl group for 5'-hydroxyl protection of deoxyribonucleoside phosphoramidites in the solid-phase preparation of DNA oligonucleotides

Several nitrogen-sulfur reagents have been investigated as potential 5'-hydroxyl protecting groups for deoxyribonucleoside phosphoramidites to improve the synthesis of oligonucleotides on glass microarrays. Out of the nitrogen-sulfur-based protecting groups so far investigated, the 2,2,5,5-tetramethylpyrrolidin-3-one-1-sulfinyl group exhibited near optimal properties for 5'-hydroxyl protection by virtue of the mildness of its deprotection conditions. Specifically, the iterative cleavage of a terminal 5'-sulfamidite group in the synthesis of 5'-d(ATCCGTAGCCAAGGTCATGT) on controlled-pore glass is efficiently accomplished by treatment with iodine in the presence of an acidic salt. Hydrolysis of the oligonucleotide to its 2'-deoxyribonucleosides upon exposure to snake venom phosphodiesterase and bacterial alkaline phosphatase did not reveal the formation of any nucleobase adducts or other modifications. These findings indicate that the 2,2,5,5-tetramethylpyrrolidin-3-one-1-sulfinyl group for 5'-hydroxyl protection of phosphoramidites, such as 10a-d, may lead to the production of oligonucleotide microarrays exhibiting enhanced specificity and sensitivity in the detection of nucleic acid targets.     

Synthesis and characterization of metal polycarboxylates constructed from lanthanides(iii) and 1,2,4,5-benzenetetracarboxylic acid

The complexes of yttrium(III) and lanthanides(III) with 1,2,4,5-benzenetetracarboxylic acid were prepared as crystalline solids of the general formula Ln₄(C₁₀H₂O₈)₃⋅14H₂O. They are insoluble in water. On heating in air or inert gas atmosphere all compounds lose water molecules; next anhydrous compounds decompose to oxides. The yttrium complex and heavy lanthanide (from Ho to Lu) ones crystallize in monoclinic crystal system. The dehydration does not change the crystal structure of the compounds.     

Effect of the fibre-forming material structure and silica nanoparticles

The paper discusses the thermal properties of alginate fibres made from alginic acid or sodium alginate and from alginates substituted with divalent metal ions during the fibre-forming stage. Alginate fibres with an addition of silica nanoparticles have also been examined. The selection of fibre-forming parameters was intended to obtain the best either sorption or strength properties depending on the specific fibre application. Thermal curves of the fibres under investigations obtained by under air atmosphere and differential scanning calorimetry (DSC) under neutral gas atmosphere have been interpreted from the view of physical and chemical changes in the fibre-forming material. Based on thermogravimetric curves, the fibre thermal stability indices have been determined. It has been found that the addition of silica nanoparticles exerts a positive influence on the thermal properties of the examined fibres.     

Electron-stimulated desorption from ionic crystal surfaces

Inelastic interactions of electrons with surfaces of ionic crystals result in emission of various particles such as ions, atoms and molecules. We will review such electron-stimulated desorption processes for the particular class of ionic crystals, namely for alkali halides. In this case, a dominant fraction of the emission is in the form of halogen and alkali atoms characterized by a thermal (Maxwellian) spectrum of translational energies. For several alkali halides (potassium and rubidium chlorides, bromides, and iodides), however, a significant part of the halogen atoms is ejected with nonthermal energies, i.e. energies of the order of 0.1 eV. The results of recent systematic studies of angular-resolved kinetic energy distributions of the emitted particles will be reported and current views on the electronic mechanisms of desorption will be described. In particular, it will be shown that the ESD mechanism can be understood in terms of the model involving a surface localisation of the so called “hot-holes” created by electron bombardment of alkali halides. A role of hot holes in ESD processes will further be discussed in relation to very recent experimental results obtained for the KBr crystals doped with In impurities which act as efficient hole traps.     

Analysis of the effect of the electronic structure of the Cl atom in complexes of chlorides of group IV elements on Cl NQR frequency and asymmetry parameter

Analysis of changes in ³⁵Cl NQR frequency of complexes MCl₄.L and MCl₄.2L for M = Si, Ge, Sn and Ti was performed. The population of the atomic orbitals was calculated by the quantum chemistry methods PM3 and INDO. The results provided an explanation of the changes in ³⁵Cl NQR frequency and the asymmetry parameter upon complex formation. In the complexes of non-transition elements, a decrease in ³⁵Cl NQR frequency is first of all related to increasing population of p_z orbitals on Cl atoms. In the complexes of Ti, the increase in ³⁵Cl NQR frequency depends on a decrease in the p_π to d_π electron density transfer.     

Hydride generation atomic absorption spectrometry with insitu graphite tube trapping for the determination of Se (IV) and Se (VI) in baltic sea water samples

This paper reports the results of an optimisation study for a procedure to determine the total selenium and its inorganic species, Se(IV) and Se(VI) using atomic absorption spectrometry combined with hydride generation and in-situ trapping of the analyte on the inner walls of the graphite tube. With the use of the proposed modification, a detection limit (3σ) of 0.018 ng/ml is achieved. This paper presents exemplary results, according to the proposed procedure, for selenium determination in samples of marine water. The concentrations of selenium in the samples ranged from <0.02 ng/ml to 0.16ng/ml of Se(IV) and from <0.02 ng/ml to 0.10 ng/ml of Se(VI).     

Spectrophotometric determination of dopamine in microliter scale using microfluidic system based on polymeric technology

In this paper we report two simple and sensitive spectrophotometric procedures for the determination of dopamine in microfluidic system based on poly(dimethylsiloxane) (PDMS) technology and comparison of their interference-susceptibility. The analytical reactions and measurements were carried out at ambient temperature in a microreactor of total volume 6 μl coupled with a spectrophotometric flow-through cuvette.     

Role of electrostatic interactions in particle adsorption

The role of the electrostatic double-layer interactions in adsorption of colloid particles at solid/liquid interface was reviewed. The phenomenological formulation of the governing PB equation was presented with the expressions for the pressure tensor enabling one to calculate forces, torques and interaction energies between particles in electrolyte solutions. Then, the limiting analytical results for an isolated double-layer (both spherical and planar) were discussed in relation to the effective surface potential concept. The range of validity of the approximate expression connecting the surface potential and the effective surface potential with surface charge for various electrolytes was estimated. The results for double-layer systems were next presented including the case of two planar double-layers and two dissimilar spherical particles. Limiting solutions for short and long distances as well as for low potentials (linear HHF model) were discussed. The approximate models for calculating interactions of spheres, i.e., the extended Derjaguin summation method and the linear superposition approach (LSA) were also introduced. The results stemming from these models were compared with the exact numerical solution obtained in bispherical coordinate system. Possibilities of describing interactions of nonspherical particles (e.g., spheroids) in terms of the Derjaguin and the equivalent sphere methods were pointed out. In further part of the review the role of these electrostatic interactions in adsorption of colloid particles was discussed. Theoretical predictions were presented enabling a quantitative determination of both the initial adsorption flux for low surface coverages and the surface blocking effects for larger surface coverages. Possibility of bilayer adsorption for dilute electrolytes was mentioned. The theoretical results concerning both the adsorption kinetics and structure formation were then confronted with experimental evidences obtained in the well-defined systems, e.g., the impinging-jet cells and the packed-bed columns of monodisperse spherical particles. The experiments proved that the initial adsorption flux was considerably increased in dilute electrolytes whereas the monolayer coverages were considerably decreased due to lateral interactions among particles. It was then concluded that the good agreement between experimental and theoretical data confirmed the thesis of an essential role of the electrostatic interactions in adsorption phenomena of colloid particles.     

Thermal copolymerization of acrylonitrile with methacrylate units arranged in matrix

Copolymerization of acrylonitrile with methacrylates on a matrix has been examined (using methacrylate of p-cresol-formaldehyde resin). It has been found that the copolymerization proceeds at 70° without an initiator. The reactivity ratios depend on the length of the matrix used. The method of calculating Q and e according to the Alfrey-Price scheme has been discussed for the system under investigation.