Synthesis of Enantiomerically Pure Ferrocenes from Glycofuranosyl-cyclopentadienes,synthetic equivalents of (alkoxyalkyl)fulvenes

Cyclopentadienyl C-glycosides (= glycosyl-cyclopentadienes) have been prepared as latent fulvenes. Their reaction with nucleophiles leads to cyclopentadienes substituted with (protected) alditol moieties and, hence, to enantiomerically pure metallocenes. Treatment of 1 with cyclopentadienyl anion gave the epimeric glycosyl-cyclopentadienes 6 / 7 (Scheme 1). Each epimer consisted of a ca. 1:1 mixture of the 1, 3-and 1, 4-cyclopentadienes a and b , respectively, which were separated by prep. HPLC. Slow regioisomerisation occurred at room temperature. Diels-Alder addition of N-phenylmaleimide to 6a / b ca. 3:7 at room temperature yielded three ‘endo’-adducts, i.e., a disubstituted alkene ( 8 or 9 , 25%) and the trisubstituted alkenes 10 (45%) and 11 (13%). The structure of 10 was established by X-ray analysis. Reduction of 6 / 7 (after isolation or in situ) with LiAlH₄ gave the cyclopentadienylmannitols 12a / b (80%) which were converted to the silyl ethers 13a / b (Scheme 2). Lithiation of 13a / b and reaction with FeCl₂ or TiCl₄ led to the symmetric ferrocene 14 (76%) and the titanocene 15 (34%), respectively. The mixed ferrocene 16 (63%) was prepared from 13a / b and pentamethylcyclopentadiene. Treatment of 6 / 7 with PhLi at ?78° gave a 5:3 mixture of the 1-C-phenylated alcohols 17a / b and 18a / b (71%) which were silylated to 19a / b and 20a / b , respectively. Lithiation of 19 / 20 and reaction with FeCl₂ afforded the symmetric ferrocenes 21 and 22 and the mixed ferrocene 23 (54:15:31, 79%) which were partially separated by MPLC. The configuration at C(1) of 17–22 was assigned on the basis of a conformational analysis. The reaction of the ribofuranose 24 with cyclopentadienylsodium led to the epimeric C-glycosides 27a / b and 28a (57%, ca. 1:1, Scheme 3). The in-situ reduction of 27 / 28 with LiAlH₄ followed by isopropylidenation gave 25a / b (65%) which were transformed into the ferrocene 26 (79%) using the standard method. Phenylation of 27 / 28 , desilylation, and isopropylidenation gave a 20:1 mixture of 33a / b and 34a / b (86%) which was separated by prep. HPLC. The same mixture was obtained upon phenylation of the fulvene 32 which was obtained in 36% yield from the reaction of the aldehydo-ribose 30 with cyclopentadienylsodium at ?100°. Lithiation of 33 / 34 and reaction with FeCl₂ gave the symmetric ferrocene 35 (88%). Similarly, the aldehydo-arabinose 36 was transformed via the fulvene 37 (32%) into a 18:1 mixture of 38a / b and 39a / b (78%) and, hence, into the ferrocene 40 (83%). Conformational analysis allowed to assign the configuration of 33–35 , whereas an X-ray analysis of 40 established the (1S)-configuration of 38a / b and 40 . The opposite configuration at C(1) of 38a / b and 33a / b was established by chemical degradation (Scheme 4). Hydrogenation (→ 41 and 44 , resp.), deprotection (→ 42 and 45 , resp.), NaIO₄ oxidation, and NaBH₄ reduction yielded (+)-(S)- 43 and (?)-(R)- 43 , respectively.     

Silylating Agents Grafted onto Silica Derived from Leached Chrysotile

Silica from leached chrysotile fibers (SILO) was silanized with trialkoxyaminosilanes to yield inorganic–organic hybrids designated SILx (x=1–3). The greatest amounts of the immobilized agents were quantified as 2.14, 1.90, and 2.18 mmol g⁻¹ on SIL1, SIL2, and SIL3 for –(CH₂)₃NH₂,–(CH₂)₃NH(CH₂)₂NH₂, and –(CH₂)₃NH(CH₂)₂NH(CH₂)₂NH₂ groups attached to the inorganic support. The infrared spectra for all modified silicas showed the absence of the Si–OH deformation mode, originally found at 950 cm⁻¹, and the appearance of asymmetric and symmetric C–H stretching bands at 2950 and 2840 cm⁻¹. Other important bands associated with the organic moieties were assigned to ν_as(NH) at 3478 and ν_sym(NH) at 3418 cm⁻¹. The NMR spectrum of the solid precursor material suggested two different kinds of silicon atoms: silanol and siloxane groups, between −90 and 110 ppm; however, additional species of silicon that contain the organic moieties bonded to silicon at −58 and −66 ppm appeared after chemical modification. These modified silicas showed a high adsorption capacity for cobalt and copper cations in aqueous solution, in contrast to the original SILO matrix, confirming the unequivocal anchoring of silylating agents on the silica surface.     

Prediction and realisation of high mobility and degenerate p-type conductivity in CaCuP thin films

Phosphides are interesting candidates for hole transport materials and p-type transparent conducting applications, capable of achieving greater valence band dispersion than their oxide counterparts due to the higher lying energy and increased size of the P 3p orbital. After computational identification of the indirect-gap semiconductor CaCuP as a promising candidate, we now report reactive sputter deposition of phase-pure p-type CaCuP thin films. Their intrinsic hole concentration and hole mobility exceed 1 × 10²⁰ cm⁻³ and 35 cm² V⁻¹ s⁻¹ at room temperature, respectively. Transport calculations indicate potential for even higher mobilities. Copper vacancies are identified as the main source of conductivity, displaying markedly different behaviour compared to typical p-type transparent conductors, leading to improved electronic properties. The optical transparency of CaCuP films is lower than expected from first principles calculations of phonon-mediated indirect transitions. This discrepancy could be partly attributed to crystalline imperfections within the films, increasing the strength of indirect transitions. We determine the transparent conductor figure of merit of CaCuP films as a function of composition, revealing links between stoichiometry, crystalline quality, and opto-electronic properties. These findings provide a promising initial assessment of the viability of CaCuP as a p-type transparent contact.

We synthesize air-stable, p-type CaCuP thin films with high hole concentration and high hole mobility as potential p-type transparent conductors. We study their optoelectronic properties in detail by advanced experimental and computational methods.     

Shear-induced particle segregation in binary mixtures:Verification of a percolation theory

Granular materials composed of different-sized grains may experience undesired segregation.Segrega-tion is detrimental for a lot of industries because it leads ...     

Thiosemicarbazide-Substituted Coumarins as Selective Inhibitors of the Tumor Associated Human Carbonic Anhydrases IX and XII

A novel series of thiosemicarbazide-substituted coumarins was synthesized and the inhibitory effects against four physiologically relevant carbonic anhydrase isoforms I, II, IX and XII showed selective activities on the tumor-associated IX and XII isozymes. Molecular modeling studies on selected compounds 14a and 22a were performed. The binding modes of such compounds were determined assuming their enzymatically active structures (i.e., cinnamic acid) in the thermodynamically favored, and not previously explored, E geometry. Molecular modelling suggests multiple interactions within the enzymatic cavity and may explain the high potency and selectivity reported for the hCAs IX and XII.     

Metabolic and Proteomic Analysis of Chlorella sorokiniana,Chloroidium saccharofilum,and Chlorella vulgaris Cells Cultured in Autotrophic,Photoheterotrophic, and Mixotrophic Cultivation Modes

Chlorella is one of the most well-known microalgal genera, currently comprising approximately a hundred species of single-celled green algae according to the AlgaeBase. Strains of the genus Chlorella have the ability to metabolize both inorganic and organic carbon sources in various trophic modes and synthesize valuable metabolites that are widely used in many industries. The aim of this work was to investigate the impact of three trophic modes on the growth parameters, productivities of individual cell components, and biochemical composition of Chlorella sorokiniana, Chloroidium saccharofilum, and Chlorella vulgaris cells with special consideration of protein profiles detected by SDS-PAGE gel electrophoresis and two-dimensional gel electrophoresis with MALDI-TOF/TOF MS. Mixotrophic conditions with the use of an agro-industrial by-product stimulated the growth of all Chlorella species, which was confirmed by the highest specific growth rates and the shortest biomass doubling times. The mixotrophic cultivation of all Chlorella species yielded a high amount of protein-rich biomass with reduced contents of chlorophyll a, chlorophyll b, carotenoids, and carbohydrates. Additionally, this work provides the first information about the proteome of Chloroidium saccharofilum, Chlorella sorokiniana, and Chlorella vulgaris cells cultured in molasses supplementation conditions. The proteomic analysis of the three Chlorella species growing photoheterotrophically and mixotrophically showed increased accumulation of proteins involved in the cell energy metabolism and carbon uptake, photosynthesis process, and protein synthesis, as well as proteins involved in intracellular movements and chaperone proteins.     

Neuroprotective Effect of Caffeine in Alzheimer’s Disease

Alzheimer’s disease (AD) is the leading cause of dementia, predicted to be the most significant health burden of the 21st century, with an estimated 131.5 million dementia patients by the year 2050. This review aims to provide an overview of the effect of caffeine on AD and cognition by summarizing relevant research conducted on this topic. We searched the Web of Science core collection and PubMed for studies related to the effect of caffeine on AD and cognition using title search terms: caffeine; coffee; Alzheimer’s; cognition. There is suggestive evidence from clinical studies that caffeine is neuroprotective against dementia and possibly AD (20 out of 30 studies support this), but further studies, such as the “ideal” study proposed in this review, are required to prove this link. Clinical studies also indicate that caffeine is a cognitive normalizer and not a cognitive enhancer. Furthermore, clinical studies suggest the neuroprotective effect of caffeine might be confounded by gender. There is robust evidence based on in vivo and in vitro studies that caffeine has neuroprotective properties in AD animal models (21 out of 22 studies support this), but further studies are needed to identify the mechanistic pathways mediating these effects.     

A longitudinal study of MR diffusion changes in normal appearing white matter of patients with early multiple sclerosis

BACKGROUND AND PURPOSE: The stage at which normal appearing white matter (NAWM) abnormalities first appear in multiple sclerosis (MS) is not clear. The aim of our study was to monitor water diffusion changes over time in NAWM of patients with early MS.METHODS: Out of a consecutive series of patients enrolled in a MR study on clinically isolated syndrome (CIS), we selected 19 subjects who had completed a one year follow-up. The MR scans obtained at baseline and at 12 months were reviewed according to the new criteria on the diagnosis of MS. Lesion load on T2 and T1 weighted images and the trace of the apparent diffusion coefficient in NAWM were measured both at baseline and at 12 months in patients and in 12 healthy controls.RESULTS: In three patients the diagnosis of MS was done at baseline based on MR. Thirteen patients developed MS during the study and in three patients the diagnosis remained "possible MS." TADC in NAWM in patients was significantly higher than in controls at the 12 months' follow-up but not at baseline (controls mean tADC +/- sd = 0.745 +/- 0.02 mm(2)/sec x 10(-3); patients mean tADC(12) +/- sd = 0.767 +/- 0.02 mm(2)/sec x 10(-3); p < 0.02). TADC and T2 lesion load at 12 months were significantly correlated (p < 0.01). Patients exhibiting tADC(12) above a confidence interval had a significantly greater EDSS score at the same time period (EDSS(12) +/- sd = 1.9 +/- 0.5 and = 1.1 +/- 0.4 respectively; p < 0.01).CONCLUSIONS: This study suggests that diffusion MR cannot detect alterations in NAWM of patients with a CIS suggestive of MS. After one year, when most patients develop MS, diffusion MR abnormalities in NAWM become apparent. These abnormalities are correlated with T2 lesion load and may contribute to neurological impairment.     

Exploring the Parallel G-Quadruplex Nucleic Acid World: A Spectroscopic and Computational Investigation on the Binding of the c-myc Oncogene NHE III1 Region by the Phytochemical Polydatin

Trans-polydatin (tPD), the 3-β-D-glucoside of the well-known nutraceutical trans-resveratrol, is a natural polyphenol with documented anti-cancer, anti-inflammatory, cardioprotective, and immunoregulatory effects. Considering the anticancer activity of tPD, in this work, we aimed to explore the binding properties of this natural compound with the G-quadruplex (G4) structure formed by the Pu22 [d(TGAGGGTGGGTAGGGTGGGTAA)] DNA sequence by exploiting CD spectroscopy and molecular docking simulations. Pu22 is a mutated and shorter analog of the G4-forming sequence known as Pu27 located in the promoter of the c-myc oncogene, whose overexpression triggers the metabolic changes responsible for cancer cells transformation. The binding of tPD with the parallel Pu22 G4 was confirmed by CD spectroscopy, which showed significant changes in the CD spectrum of the DNA and a slight thermal stabilization of the G4 structure. To gain a deeper insight into the structural features of the tPD-Pu22 complex, we performed an in silico molecular docking study, which indicated that the interaction of tPD with Pu22 G4 may involve partial end-stacking to the terminal G-quartet and H-bonding interactions between the sugar moiety of the ligand and deoxynucleotides not included in the G-tetrads. Finally, we compared the experimental CD profiles of Pu22 G4 with the corresponding theoretical output obtained using DichroCalc, a web-based server normally used for the prediction of proteins’ CD spectra starting from their “.pdb” file. The results indicated a good agreement between the predicted and the experimental CD spectra in terms of the spectral bands’ profile even if with a slight bathochromic shift in the positive band, suggesting the utility of this predictive tool for G4 DNA CD investigations.