2,2,5,5-tetramethylpyrrolidin-3-one-1-sulfinyl group for 5'-hydroxyl protection of deoxyribonucleoside phosphoramidites in the solid-phase preparation of DNA oligonucleotides

Several nitrogen-sulfur reagents have been investigated as potential 5'-hydroxyl protecting groups for deoxyribonucleoside phosphoramidites to improve the synthesis of oligonucleotides on glass microarrays. Out of the nitrogen-sulfur-based protecting groups so far investigated, the 2,2,5,5-tetramethylpyrrolidin-3-one-1-sulfinyl group exhibited near optimal properties for 5'-hydroxyl protection by virtue of the mildness of its deprotection conditions. Specifically, the iterative cleavage of a terminal 5'-sulfamidite group in the synthesis of 5'-d(ATCCGTAGCCAAGGTCATGT) on controlled-pore glass is efficiently accomplished by treatment with iodine in the presence of an acidic salt. Hydrolysis of the oligonucleotide to its 2'-deoxyribonucleosides upon exposure to snake venom phosphodiesterase and bacterial alkaline phosphatase did not reveal the formation of any nucleobase adducts or other modifications. These findings indicate that the 2,2,5,5-tetramethylpyrrolidin-3-one-1-sulfinyl group for 5'-hydroxyl protection of phosphoramidites, such as 10a-d, may lead to the production of oligonucleotide microarrays exhibiting enhanced specificity and sensitivity in the detection of nucleic acid targets.     

Tetraphenylporphyrins monosubstituted with a crown ether in one phenyl ring. Synthesis and characterization

Summary The synthesis and spectroscopic characterization of seven new tetraphenyl-porphyrins (1–7) derivatized with 12-crown-4, 14-crown-4, 15-crown-5, or 18-crown-6 ether units inortho orpara position of one of the phenyl rings is described.

---

In einem Phenylring mit Kronenethern monosubstituierte Tetraphenylporphyrine. Synthese und Charakterisierung

Zusammenfassung Die Synthese und die spektroskopische Charakterisierung sieben neuer Tetraphenylporphyrine (1–7), die mit 12-Krone-4, 14-Krone-4, 15-Krone-5 oder 18-Krone-6 in derortho-oderpara-Position eines Phenylrings substituiert sind, werden beschrieben.

     

Reintroducing anisotropic interactions in magic-angle-spinning NMR of half-integer quadrupolar nuclei: 3D MQMAS

Selective reintroduction of anisotropic interactions such as the chemical shift anisotropy (CSA) and homonucler dipolar (HMD) coupling were implemented in a high-resolution NMR spectroscopy for half-integer quadrupolar nuclei. Rotary resonance recoupling (R(3)) combined with the multiple-quantum magic-angle spinning (MQMAS) in a three-dimensional (3D) experiment provides not only site-specific high-resolution spectra to yield the quadrupolar interaction parameters but also the CSA or HMD interaction parameters. This 3D experiment provides an avenue for the complete local structural information of half-integer quadrupolar nuclei. Three-dimensional MQMAS experiments incorporating R(3) of HMD and CSA interactions were demonstrated on model compounds containing (11)B, (23)Na, and (87)Rb nuclei.     

Mechanism of the thermal decomposition of hydrophosphites of lithium,sodium and potassium

The thermal decomposition of some M ₂ ^I HPO₃ (M-Li, Na, K) phosphites under nitrogen atmosphere was investigated. A stepwise mechanism of thermal decomposition has been proposed.

---

Zusammenfassung Es wurde die thermische Zersetzung von Phosphiten M ₂ ^I HPO₃ (M-Li, Na, K) in Stickstoffatmosphere untersucht. Die Schritte des Mechanismus der thermischen Zersetzung wurden vorgeschlagen.

     

Binary and ternary chromium(III) complexes with cellular reductants and DNA components isolated from redox type systems. Part 1. Chromium(VI)–cysteine–adenine (adenosine,ATP)

The reduction of CrO₃ with an excess of L-cysteine and its interaction with DNA fragments (adenine, adenosine) and ATP nucleotide was studied by analysis of the isolated solid products. The precipitates were characterised by elemental analyses, FAB mass spectral data, spectroscopic methods (u.v.–vis., f.i.r., i.r.) and magnetic measurements. The Cr^III complexes obtained appear to be various Cr^III cysteinate and adenine or ATP (but not adenosine) ternary species of the addition type bound through the hydrogen bonding network.     

Groups of paramagnetic centres in coal samples with different carbon contents

Complex systems of paramagnetic centres existing in demineralised flame coal (71.4 wt% C), medium-rank coal (85.6 wt% C) and anthracite (94.9 wt% C) were analysed by electron paramagnetic resonance spectroscopy (EPR). Different groups of paramagnetic centres were searched in macerals (exinite, vitrinite, inertinite) of coals with carbon contents of 73.8 wt% C and 85.6 wt% C. Experimental EPR spectra were fitted by different superposition of theoretical lines. Total concentration of paramagnetic centres both in coal and macerals increases with carbon content in the sample. Total concentration of paramagnetic centres in macerals increases from exinite to inertinite. Four groups of paramagnetic centres were found in medium-rank coal, and only two groups exist in flame coal and anthracite. The EPR spectrum of medium-rank coal is a superposition of two broad and two narrow lines. Both broad and narrow, and two narrow lines were measured in EPR spectra of flame coal and anthracite, respectively. Two types of paramagnetic centres with broad lines and one group with narrow lines exist in exinite and vitrinite from medium-rank coal. Two narrow components were observed in EPR spectra of its inertinite. Two different broad electron paramagnetic resonance signals were detected for macerals from low-coalificated coal. Paramagnetic centres systems of medium-rank coal samples reveal the most complex character. Broad EPR lines were not observed for the higher coalificated samples, i.e., anthracite and inertinite from medium-rank coal. Narrow lines do not occur in EPR spectra of low-coalificated macerals. Strong dipolar interactions and fast spin-lattice relaxation processes are characteristic for paramagnetic centres with broad lines. Strong exchange interactions and short spin-lattice relaxation time were measured for paramagnetic centres with the narrowest EPR signals.     

Synthesis and properties of 1-(6-methoxy)-2-benzothiazolyl)-2-pyridones

Substituted ]-(6-methoxy-2-benzothiazolyt)-2-pyridones were prepared from 2-amino-6-methoxybenzathiazate through N-(6-methoxy-2-benzothiazotyl) cyanvorearmileaznd-3-aryl-N-(6-methoxy-2-benzothiazolyt)-2-cyano-2-propenamides. The cyclization of the latter with malonodinitrile in the presence of piperidine gave the corresponding pyridones. The structures of the synthesized compounds were confirmed by¹H NMR and mass spectral data.Department of Organic Chemistry, Mass Spectrometry Laboratory, Slovak Technical University, 812 37 Bratislava, Slovakia. Published in Khimiya Geterotsiklicheskikh Soedinenii, No. 10, pp. 1402–1404, October, 1995. Original article submitted August 24, 1995.     

Carrier influence on the paramagnetic and catalytic properties of supported titanium complexes

Alumina-silica possessing various Al₂O₃/SiO₂ ratios was used as a carrier of surface titanium complexes. The systems obtained were examined as models for the investigation of the macroligand (inorganic gel) influence on the physicochemical properties of supported transition metal complexes. The titanium complexes were prepared first by the reaction of CpTiCl₃, with the hydroxyl groups of the gel and then reduced by an excess of BuLi. The influence was established of the basic gel properties on: (a) the amount of titanium(IV) and titanium(III) complexes on the alumina-silica gel surfaces; (b) the symmetry of the surface Ti^III surface complexes; (c) the electron density around the surface-Ti^III ions, ionic or covalent bonds character in a complex; and (d) the catalytic activity in olefin hydrogenation.     

Cis-coordination of the chromate anions in helical Co/Ni block-type polymeric systems. Structural and spectroscopic characteristics of catena(μ-CrO4-O,O′)[Co(HIm)3H2O] and catena(μ-CrO4-O,O′)[Co0.43Ni0.57(HIm)3H2O]

Two polymeric complexes: catena(μ-CrO₄-O,O′)[Co(HIm)₃H₂O] (1) and catena(μ-CrO₄-O,O′)[Co_0.43Ni_0.57(HIm)₃H₂O] (2) (where HIm=imidazole) with a cis-bridging coordination mode of the CrO₄ ²⁻ anion have been synthesized and characterized by X-ray and spectroscopic methods. These crystals were isolated from nine systems of varying reagent molar ratios and three excluding anions: Cl⁻, NO₃ ⁻ and SO₄ ²⁻ exclusively as mer [M(HIm)₃O₃]-type isomers. The unit cell of these isostructural complexes (monoclinic crystal system P2₁ /n) contains two independent helixes, left- and right handed, stabilized by intrahelical and interhelical hydrogen bonding and π–π interaction between pairs of the imidazole rings from neighbouring helixes. The Raman spectra at 77 K of 1 and 2 deconvoluted into lorentzian components revealed the block-type polymeric structure of the complexes. Moreover, the solution studies at millimolar concentrations of 1 and 2 indicated their complete decomposition in water. Four K electronic spectral analysis of the crystals (band deconvolution into gaussian components) enhanced with the data obtained in the polarized light allowed for assignment of the bands to the respective d–d transition (D_4h symmetry). It was found that the metallic centres are independently absorbing species, which supports the suggestion of a block-type structure of the polymers. The respective crystal field parameters for Co and Ni were calculated.     

Studies of the Factors Controlling Regioselective Nucleophilic Addition to Dienylium-Iron Complexes

Tricarbonyl(4-alkoxyl-1-alkylcyclohexadienylium)iron complexes (I) react with metal-cation enolate nucleophiles to give in most cases a mixture of products (II) and (III), resulting from attack at the C-1 and C-5 termini of the dienylium ring. Factors that control the regioselectivity of nucleophilic addition, including the steric and electronic effects of the 4-alkoxyl and 1-alkyl substituents, the degree of association between the enolate nucleophiles and their counterions, and the polarity of the solvents, were investigated.