2,2,5,5-tetramethylpyrrolidin-3-one-1-sulfinyl group for 5'-hydroxyl protection of deoxyribonucleoside phosphoramidites in the solid-phase preparation of DNA oligonucleotides

Several nitrogen-sulfur reagents have been investigated as potential 5'-hydroxyl protecting groups for deoxyribonucleoside phosphoramidites to improve the synthesis of oligonucleotides on glass microarrays. Out of the nitrogen-sulfur-based protecting groups so far investigated, the 2,2,5,5-tetramethylpyrrolidin-3-one-1-sulfinyl group exhibited near optimal properties for 5'-hydroxyl protection by virtue of the mildness of its deprotection conditions. Specifically, the iterative cleavage of a terminal 5'-sulfamidite group in the synthesis of 5'-d(ATCCGTAGCCAAGGTCATGT) on controlled-pore glass is efficiently accomplished by treatment with iodine in the presence of an acidic salt. Hydrolysis of the oligonucleotide to its 2'-deoxyribonucleosides upon exposure to snake venom phosphodiesterase and bacterial alkaline phosphatase did not reveal the formation of any nucleobase adducts or other modifications. These findings indicate that the 2,2,5,5-tetramethylpyrrolidin-3-one-1-sulfinyl group for 5'-hydroxyl protection of phosphoramidites, such as 10a-d, may lead to the production of oligonucleotide microarrays exhibiting enhanced specificity and sensitivity in the detection of nucleic acid targets.     

Gemini-induced columnar jointing in vitreous ice. Cryo-HRSEM as a tool for discovering new colloidal morphologies

A gemini surfactant is able to promote columnar jointing in vitreous ice where long pillars, often of hexagonal cross section, are formed. This jointing is visible by cryo-high-resolution scanning electron microscopy (cryo-HRSEM), in which colloidal suspensions in bulk water are cooled rapidly in liquid ethane, thereby avoiding the potential artifacts with other types of EM. The jointing is proposed to arise from a new type of colloidal morphology where the surfactant self-assembles into hexagonal columns. Evidence for this mechanism comes from a cryo-HRSEM photo of an ice-free hexagonal "skeleton" composed of surfactant. Cryo-HRSEM, a method that is just beginning to realize its potential, would seem to have a promising future in the discovery of additional and as yet unimagined colloidal structures.     

High-frequency (140-GHz) time domain EPR and ENDOR spectroscopy: the tyrosyl radical-diiron cofactor in ribonucleotide reductase from yeast

High-frequency pulsed EPR and ENDOR have been employed to characterize the tyrosyl radical (Y*)-diiron cofactor in the Y2-containing R2 subunit of ribonucleotide reductase (RNR) from yeast. The present work represents the first use of 140-GHz time domain EPR and ENDOR to examine this system and demonstrates the capabilities of the method to elucidate the electronic structure and the chemical environment of protein radicals. Low-temperature spin-echo-detected EPR spectra of yeast Y* reveal an EPR line shape typical of a tyrosyl radical; however, when compared with the EPR spectra of Y* from E. coli RNR, a substantial upfield shift of the g(1)-value is observed. The origin of the shift in g(1) was investigated by 140-GHz (1)H and (2)H pulsed ENDOR experiments of the Y2-containing subunit in protonated and D(2)O-exchanged buffer. (2)H ENDOR spectra and simulations provide unambiguous evidence for one strongly coupled (2)H arising from a bond between the radical and an exchangeable proton of an adjacent residue or a water molecule. Orientation-selective 140-GHz ENDOR spectra indicate the direction of the hydrogen bond with respect to the molecular symmetry axes and the bond length (1.81 A). Finally, we have performed saturation recovery experiments and observed enhanced spin lattice relaxation rates of the Y* above 10 K. At temperatures higher than 20 K, the relaxation rates are isotropic across the EPR line, a phenomenon that we attribute to isotropic exchange interaction between Y* and the first excited paramagnetic state of the diiron cluster adjacent to it. From the activation energy of the rates, we determine the exchange interaction between the two irons of the cluster, J(exc) = -85 cm(-)(1). The relaxation mechanism and the presence of the hydrogen bond are discussed in terms of the differences in the structure of the Y*-diiron cofactor in yeast Y2 and other class I R2s.     

Transport properties of alkyltrimethylammonium bromide surfactants in aqueous solutions

Differential mutual diffusion coefficients of n-alkyltrimethylammonium bromides [CH₃(CH₂)_n–1N(CH₃)₃Br, C_nTAB] (n=10, 12, 14, 16) have been measured in aqueous solutions at 298.15 K using a conductimetric cell and an automatic apparatus to follow diffusion. The cell is based on an open-ended capillary, and the technique follows the diffusion process by measuring the resistance of a solution inside the capillaries at various times. The electrical conductances of those solutions have also been measured to calculate the critical micellar concentration (cmc). Thermodynamic analysis of the data suggests that the free ion concentration decreases at concentrations above the cmc, in agreement with theoretical predictions. The obtained values of the micellization parameters were used to model the mutual diffusion coefficients of C_nTAB aqueous solutions.     

Detection of metal ions using ion-channel sensor based on self-assembled monolayer of thioctic acid

Gold electrodes were chemically modified with thioctic acid monolayer designed to mimic biological ion-channel membranes. The technique was then used in the determination of alkali, alkaline earth, thallium(I), and lanthanum metal cations as analytes. Cyclic voltammograms (CV) of [Fe(CN)6]³⁻ an electroactive marker, were measured in the presence of the various types of analyte cations. In the absence of the analyte cation, electrostatic repulsion between the marker anions and the carboxylate groups of the receptor monolayer hindered the approach of the marker anion to the electrode surface and hence hindered its reduction. The modified electrodes responded well to the metal cations except the alkali metal cations. The sensors could detect the trivalent cation La³⁺ at concentrations as low as 10⁻⁸ M. The response of the sensor to the metal cations increase in the order alkali metal3+ can be discriminated in the ratio 1:100. This makes it possible to determine the trivalent ion in a sample matrix containing monovalent and divalent cations. Thallium(I) ion showed marked deviation in its response as compared to monovalent ions of the alkali metals. The ion-channel sensor based on self-assembled monolayer of thioctic acid therefore offers a potential alternative technique for the selective determination of metal ions.     

Synthesis, structure and reactivity of binuclear metal-metal bonded molybdenum(V) and tungsten(V) thioselenohalides: Molecular structure of Mo2(μ-S2)2Cl6(SeCl2)2 and W2(μ-S2)2Cl6(SeCl2)2

Thioselenohalide complexes Mo₂(μ-S₂)₂Cl₆(SeCl₂)₂ (I), Mo₂(μ-S₂)₂Br₆(SeBr₂)₂ (II), and W₂(μ-S₂)₂Br₆(SeBr₂)₂ (III) were synthesized by the reactions of corresponding metal halides or carbonyls or molybdenum metal with excesses of S₂ X ₂+Se₂ X ₂ mixtures. The complex W₂(μ-S₂)₂Cl₆(SeCl₂)₂ (IV) was obtained by an exchange reaction between (III) and excess of Se₂Cl₂. Coordination of the neutral SeX ₂ ligands to thiohalidesM ₂(μ-S₂)₂ X ₆ results in higher thermal stability, and suggests the possibility to synthesize SeX ₂ complexes of the unstable parent tungsten thiohalides. An unusual oxidative addition reaction of (I) was detected: {fx27-1} Both (I) and (IV) were characterized by X-ray crystal structure analysis. They are isostructural and form discrete molecules. Bridging S ₂ ^2? ligands are coordinated perpendicularly to the metal-metal bond;d(M?M)=2.8066 Å and 2.793 Å for I and IV, respectively. Nonequivalence of chlorine atoms which are bound to the metal atom, relate to nonequivalence of halogen atoms in the complexesM ₂(μ?S₂)₂ X ₈ ^2? . Chlorine atomstrans to SeCl₂ ligands form short bonds with the metal; the corresponding³⁵Cl NQR frequency is increased. The selenium dichloride ligand is ambidentate. The selenium atom binds as a donor to the metal and as an acceptor to two chlorine atoms which are also bound covalently to the same metal atom.     

Structurally Controlled Porphyrin-Aggregation Process in Phospholipid Membranes

Abstract— Structurally controlled aggregation course for five porphyrins (etioporphyrin [EP], 5-mono- and 5,15-di-[ p -tol-yl]etioporphyrin [TP and DTP], 5,10,15,20-tetrakis[ p -tol-y1]porphin [TTP], and 5,10,15,20-tetrakis[3,5-di- tert -bu-tylphenyl]porphin [TBP]) in dipalmitoyl-phosphatidyl-choline liposomes has been monitored by fluorescence and absorption spectroscopy. While TBP shows no tendency to aggregate in liposomes, EP, TP, DTP and TTP form a porphyrin-enriched domain in membrane interior with time. The further aggregation steps within porphyrin clusters resulting in formation of stacked porphyrin aggregates have been observed for EP, TP and DTP.     

Mesoporous silica-supported uranyl: synthesis and photoreactivity

A mesoporous silica-supported uranyl material (U(aq)O(2)(2+)-silica) was prepared by a co-condensation method. Our approach involves an I(-)M(+)S(-) scheme, where the electrostatic interaction between the anionic inorganic precursor (I(-)), surfactant (S(-)), and cationic mediator (M(+)) provides the basis for the stability of the composite material. The synthesis was carried out under acidic conditions, where the anionic sodium dodecyl sulfate provided the template for the uranyl cation and silicate to condense. Excitation with visible or near-UV light of aqueous suspensions of U(aq)O(2)(2+)-silica generates an excited state that decays with k(0) = 1.5 x 10(4) s(-1). The reaction of the excited state with aliphatic alcohols exhibits kinetic saturation and concentration-dependent kinetic isotope effects. For 2-propanol, the value of k(C)3(H)7(OH)/k(C)()3(D)7(OH) decreases from 2.0 at low alcohol concentrations to 1.0 in the saturation regime at high alcohol concentrations. Taken together, the data describe a kinetic system controlled by chemical reaction at one extreme and diffusion at the other. At low [alcohol], the second-order rate constants for the reaction of silica-U(aq)O(2)(2+) with methanol, 2-propanol, 2-butanol, and 2-pentanol are comparable to the rate constants obtained for these alcohols in homogeneous aqueous solutions containing H(3)PO(4). Under slow steady-state photolysis in O(2)-saturated suspensions, U(aq)O(2)(2+)-silica acts as a photocatalyst for the oxidation of alcohols with O(2).     

Thin-Layer Chromatography with an Isolated Support and Forced Flow of the Mobile Phase

JPC – Journal of Planar Chromatography – Modern TLC -