Origin of high second- and third-order nonlinear optical response in ammonio/borato diphenylpolyene zwitterions: the remarkable role of polarized aromatic groups

We present a quantum-chemical analysis of the molecular structure and second- and third-order polarizabilities in a series of promising nonlinear optical (NLO) chromophores, the zwitterionic ammonio/borato diphenylpolyenes, R3N+Ph(C=C)nPhB-R3, whose synthesis has been reported recently. The molecular geometries are obtained via MP2/6-31G optimization, while the NLO properties are calculated with the INDO Hamiltonian using the sum-over-states and finite-field real-space methods. The real-space approach allows the direct evaluation of the NLO-active segments of the molecules, while the sum-over-states results illustrate the virtual excitations and charge-transfer pathways that are essential in the NLO response. Both methods highlight the remarkable and unexpected result that it is the strongly polarized phenylene groups that play the key role in generating a high NLO response.     

Synthesis and anion binding properties of 2,5-diamidothiophene polypyrrole Schiff base macrocycles

[reaction: see text] Two easy-to-synthesize polypyrrolic 2,5-diamidothiophene Schiff base macrocycles are reported, along with their anion binding properties as determined via UV-vis spectroscopic titrations carried out in dichloroethane. There is a striking difference between the interactions with anions of the two macrocycles, a finding ascribed to differences in their rigidity. For example, the more flexible dipyrromethane-derived macrocycle displays a 1.2:1 hydrogen sulfate versus nitrate selectivity, while its more rigid bipyrrole-derived congener shows a 7.4:1 selectivity in favor to hydrogen sulfate.     

Oriented immobilization of Desulfovibrio gigas hydrogenase onto carbon electrodes by covalent bonds for nonmediated oxidation of H2

The orientation of hydrogenase bound covalently to a pyrolytic graphite edge electrode modified with a 4-aminophenyl monolayer can be modulated via electrostatic interactions during the immobilization step. At low ionic strength and when the amino groups of the electrode surface are mostly protonated, the hydrogenase is immobilized with the negatively charged region that surrounds its 4Fe4S cluster nearer to the protein surface facing the electrode. This allows direct electron transfer between the immobilized hydrogenase and the electrode, which is observed by the strong catalytic currents measured in the presence of the H2 substrate. Therefore, a very stable enzymatic electrode is produced that catalyzes nonmediated H2 oxidation.     

2,2,5,5-tetramethylpyrrolidin-3-one-1-sulfinyl group for 5'-hydroxyl protection of deoxyribonucleoside phosphoramidites in the solid-phase preparation of DNA oligonucleotides

Several nitrogen-sulfur reagents have been investigated as potential 5'-hydroxyl protecting groups for deoxyribonucleoside phosphoramidites to improve the synthesis of oligonucleotides on glass microarrays. Out of the nitrogen-sulfur-based protecting groups so far investigated, the 2,2,5,5-tetramethylpyrrolidin-3-one-1-sulfinyl group exhibited near optimal properties for 5'-hydroxyl protection by virtue of the mildness of its deprotection conditions. Specifically, the iterative cleavage of a terminal 5'-sulfamidite group in the synthesis of 5'-d(ATCCGTAGCCAAGGTCATGT) on controlled-pore glass is efficiently accomplished by treatment with iodine in the presence of an acidic salt. Hydrolysis of the oligonucleotide to its 2'-deoxyribonucleosides upon exposure to snake venom phosphodiesterase and bacterial alkaline phosphatase did not reveal the formation of any nucleobase adducts or other modifications. These findings indicate that the 2,2,5,5-tetramethylpyrrolidin-3-one-1-sulfinyl group for 5'-hydroxyl protection of phosphoramidites, such as 10a-d, may lead to the production of oligonucleotide microarrays exhibiting enhanced specificity and sensitivity in the detection of nucleic acid targets.     

Use of diode-array detectors for the simultaneous spectrophotometric determination of calcium and magnesium by flow injection

A method for the simultaneous flow injection spectrophotometric determination of calcium and magnesium with Arsenazo III based on the use of diode-array detector and merging zones is described. The method is applicable to the resolution of mixtures in which the chromogenic reagent has a high absorbance and its spectrum strongly overlaps those of its complexes. In resolving the mixtures, the excess reagent is considered as another component. Quantitation is based on the normal absorbance and first-derivative absorbance spectra. The method is applied to 0.2–1.5 μg ml^?1 Ca and 0.1–1.0 μg ml^?1 Mg. The analysis rate is 50 h^?1.     

Simultaneous determination of two components by spectrofluorimetric techniques

A procedure is described for the resolution of two-component mixtures by use of data from variable-angle fluorescence spectrometry. The experimental data are treated by multilinear regression. The method is applied to the resolution of mixtures of fluorescein and dichlorofluorescein at the ng ml^?1 level; mean errors are < 4%.     

1-Methoxycarbonyl-substituiertes 2,3-Dihydropyridin-4(1H)-on (= Methyl-1,2,3,4-tetrahydro-4-oxopyridin-1-carboxylat) als Chromophor für die photochemische [2 + 2]-Cycloaddition

1-Methoxycarbonyl-Substituted 2,3-Dihydropyridin-4(1H)-one(= Methyl 1,2,3,4-Tetrahydro-4-oxopyridine-1-carboxylate) as Chromophore for Photochemical [2 + 2]-Cycloadditions With olefins having an electron-acceptor as well as with olefins having an electron-donor substituent, 1-methoxycarbonyl-substituted dihydropyridinone 12 undergoes [2 + 2] cycloaddition in good preparative yields. The photochemical cycloaddition is highly regioselective. For preparative purposes, the ring junction can be equilibrated to the thermodynamically more stable cis-junction. Only the ‘endo’/‘exo’ selectivity at the C-atom bearing the olefin substituent cannot be controlled. The photodimerization of 12 is the only side reaction. Using a slight excess of the olefin, the photodimerization can be suppressed. The protecting group at the N-atom of the dihydropyridinone can be varied in order to introduce an internal sensitizer, as shown with 1-acyl-substituted compound 29 , which underwent the cycloaddition process even with sunlight.     

Flexible ureasil hybrids with tailored optical properties through doping with metal nanoparticles

Hybrid organic-inorganic nanocomposites containing uniform distributions of metal nanoparticles have been prepared by mixing a preformed nanoparticle colloid with the precursors of a ureasil, prior to the sol-gel transition. These nanocomposites possess not only high optical quality and optical features dictated by the size and shape of the nanoparticle dopants but also a high degree of flexibility, which can largely enhance the range of applications in practical devices. The deposition of a uniform silica shell on the nanoparticle surface prior to the sol-gel transition was found to be required to maintain the colloidal stability during the process and, thus, to retain the optical properties in the final nanocomposite material. This method can be readily extended to other materials, such as semiconductor and magnetic nanoparticles.     

Stereoselective synthesis of individual isomers of Leu-enkephalin analogues containing substituted beta-turn bicyclic dipeptide mimetics

Novel constrained beta-turn dipeptide mimetics, 8-phenyl thiaindolizidinone amino acids 3, have been synthesized stereoselectively and incorporated into Leu-enkephalin peptides as a replacement of dipeptide Gly3-Phe4 to afford four individual isomers of Leu-enkephalin analogues 6.