Industrial methods for the production of optically active intermediates

Enantiomerically pure amino acids, amino alcohols, amines, alcohols, and epoxides play an increasingly important role as intermediates in the pharmaceutical industry and agrochemistry, where both a high degree of purity and large quantities of the compounds are required. The chemical industry has primarily relied upon established chemical methods for the synthesis of these intermediates, but is now turning more and more to enzymatic and biotechnological fermentation processes. For the industrial implementation of many transformations alternative methods are available. The advantages of the individual methods will be discussed herein and exemplified by syntheses of relevant compounds.     

Microwave spectra and structures of KrAuF, KrAgF, and KrAgBr; 83Kr nuclear quadrupole coupling and the nature of noble gas-noble metal halide bonding

Microwave spectra of the complexes KrAuF and KrAgBr have been measured for the first time using a cavity pulsed jet Fourier transform microwave spectrometer. The samples were prepared by laser ablation of the metal from its solid and allowing the resulting plasma to react with an appropriate precursor (Kr, plus SF6 or Br2) contained in the backing gas of the jet (usually Ar). Rotational constants; geometries; centrifugal distortion constants; vibration frequencies; and 197Au, 79Br, and 81Br nuclear quadrupole coupling constants have all been evaluated. The complexes are unusually rigid and have short Kr-Au and Kr-Ag bonds. The 197Au nuclear quadrupole coupling constant differs radically from its value in an AuF monomer. In addition 83Kr hyperfine structure has been measured for KrAuF and the previously reported complex KrAgF. The geometry of the latter has been reevaluated. Large values for the 83Kr nuclear quadrupole coupling constants have been found for both complexes. Both the 197Au and 83Kr hyperfine constants indicate a large reorganization of the electron distribution on complex formation. A thorough assessment of the nature of the noble gas-noble metal bonding in these and related complexes (NgMX; Ng is a noble gas, M is a noble metal, and X is a halogen) has been carried out. The bond lengths are compared with sums of standard atomic and ionic radii. Ab initio calculations have produced dissociation energies along with Mulliken populations and other data on the electron distributions in the complexes. The origins of the rigidity, dissociation energies, and nuclear quadrupole coupling constants are considered. It is concluded that there is strong evidence for weak noble gas-noble metal chemical bonding in the complexes.     

Star-shaped azo-based dipolar chromophores: design, synthesis, matrix compatibility, and electro-optic activity

Three new azo-benzene-based push-pull chromophores with dendritic architecture were synthesized as active materials for electro-optic applications. These chromophores were synthesized in six or seven synthetic steps with an overall yield of around 80% per step and high purity. UV-vis spectroscopy showed significant influence of the transient dipole moment on the observed r(33) values. The chromophores were stable to photochemical oxidation in ambient light and air. The electrical poling conditions were optimized for each chromophore as the T(g) of the composite material varied significantly. The highest EO coefficient achieved was 22-25 pm/V at 1550 nm wavelength. STEM analysis of the blends enabled the correlation of the activity of these large chromophores with the blend morphology. An amorphous polycarbonate host effectively disperses the chromophores in 2-20 nm aggregates in the active materials. However, macrophase separation into 200-500 nm aggregates was observed in a methacrylate host matrix.     

Os(II)-nitrosyl and Os(II)-dinitrogen complexes from reactions between Os(VI)-nitrido and hydroxylamines and methoxylamines

Reactions between the Os(VI)-nitrido salts (e.g., trans-[Os(VI)(tpy)(Cl)(2)(N)]PF(6) (tpy = 2,2':6',2"-terpyridine), cis-[Os(VI)(tpy)(Cl)(2)(N)]PF(6), and fac-[Os(VI)(tpm)(Cl)(2)(N)]PF(6) (tpm = tris(pyrazol-1-yl)methane)) and the hydroxylamines (e.g., H(2)NOH and MeHNOH) and the methoxylamines (e.g., H(2)NOMe and MeHNOMe) in dry MeOH at room temperature give three different types of products. They are Os(II)-dinitrogen (e.g., trans-, cis-, or fac-[Os(II)-N(2)]), Os(II)-nitrosyl [Os(II)-NO](+) (e.g., trans- or cis-[Os(II)-NO](+)), Os(IV)-hydroxyhydrazido (e.g., cis-[Os(IV)-N(H)N(Me)(OH)](+)), and Os(IV)-methoxyhydrazido (e.g., trans-/cis-[Os(IV)-N(H)N(H)(OMe)](+), and trans-/cis-[Os(IV)-N(H)N(Me)(OMe)](+)) adducts. The products depend in a subtle way on the electron content of the starting nitrido complexes, the nature of the hydroxylamines, the nature of the methoxylamines, and the reaction conditions. Their appearance can be rationalized by invoking the formation of a series of related Os(IV) adducts which are stable or decompose to give the final products by two different pathways. The first involves internal 2-electron transfer and extrusion of H(2)O, MeOH, or MeOMe to give [Os(II)-N(2)]. The second which gives [Os(II)-NO](+) appears to involve seven-coordinate Os(IV) intermediates based on the results of an (15)N-labeling study.     

Synthesis and structural characterization of trivalent amino acid derived chiral phosphorus compounds

Reaction of the N-toluenesulfonyl derivatives of (S)-alanine, phenylalanine, and valine (4-6) with PhPCl(2) gave in high yield the 4-methyl, benzyl, and isopropyl derivatives (7-9) of 2-phenyl-1-p-toluenesulfonyl-1,3,2-oxazaphospholidin-5-one. The ratios of the (2S,4S)/(2R,4S) diastereomers (cis/trans isomers) were 1:1, 2:1, and 10:1 for the methyl, benzyl, and isopropyl derivatives 7a,b, 8a,b, and 9a,b, respectively. For 7a,b, both isomers could be crystallized, but for the others only the major isomers were isolable. The X-ray crystal structure of 9a shows that the isopropyl and phenyl groups are mutually cis and that the tolyl moiety is oriented s-trans to both the isopropyl and phenyl groups. Reaction of 6 with Cl(2)PCH(2)CH(2)PCl(2) (10) gave a 56:38:7 mixture of the cis/cis, cis/trans, and trans/trans diphosphorus heterocycles 11a-c. The major isomer could be crystallized and isolated free of the other diastereomers. Reaction of 6 with EtPCl(2) gave a 6:1 mixture of cis/trans isomers of the ethyl-substituted heterocycles 12a,b as an inseparable oil but allowed confirmation of the structure of 11a. Slow epimerization at phosphorus may occur by inversion but more likely by ring opening/closure, since 7b, 9a, and 11a give rise upon standing in solution to mixtures containing starting material and 7a, 9b, and 11b, respectively, along with the free amino acid derivatives 4 and 6. The NMR spectra, and in particular the coupling constants between the alpha-hydrogen atom of the amino acid moiety and phosphorus, were used to establish the identities of the cis and trans isomers. Reaction of 9a with (THF)W(CO)(5) gave the phosphorus-ligated adduct (9a)W(CO)(5) (13), and the IR spectrum of this complex shows that 9a is a strongly electron-withdrawing ligand. The geometry of the sulfonamide moiety is discussed in detail, as are the (1)H NMR coupling constants. The data are consistent with the presence of little steric interaction between the cis isopropyl and phosphorus substituent in 9a, 11a, and 12a and orientation of the tolyl moiety s-cis to the isopropyl group in 9b, 12b, and 13.     

Solid-phase synthesis of positively charged deoxynucleic guanidine (DNG) tethering a Hoechst 33258 analogue: triplex and duplex stabilization by simultaneous minor groove binding

Deoxynucleic guanidine (DNG), a DNA analogue in which positively charged guanidine replaces the phosphodiester linkages, tethering to Hoechst 33258 fluorophore by varying lengths has been synthesized. A pentameric thymidine DNG was synthesized on solid phase in the 3' --> 5' direction that allowed stepwise incorporation of straight chain amino acid linkers and a bis-benzimidazole (Hoechst 33258) ligand at the 5'-terminus using PyBOP/HOBt chemistry. The stability of (DNA)(2).DNG-H triplexes and DNA.DNG-H duplexes formed by DNG and DNG-Hoechst 33258 (DNG-H) conjugates with 30-mer double-strand (ds) DNA, d(CGCCGCGCGCGCGAAAAACCCGGCGCGCGC)/d(GCGGCGCGCGCGCTTTTTGGGCCGCGCGCG), and single-strand (ss) DNA, 5'-CGCCGCGCGCGCGAAAAACCCGGCGCGCGC-3', respectively, has been evaluated by thermal melting and fluorescence emission experiments. The presence of tethered Hoechst ligand in the 5'-terminus of the DNG enhances the (DNA)(2).DNG-H triplex stability by a DeltaT(m) of 13 degrees C. The fluorescence emission studies of (DNA)(2).DNG-H triplex complexes show that the DNG moiety of the conjugates bind in the major groove while the Hoechst ligand resides in the A:T rich minor groove of dsDNA. A single G:C base pair mismatch in the target site decreases the (DNA)(2).DNG triplex stability by 11 degrees C, whereas (DNA)(2).DNG-H triplex stability was decreased by 23 degrees C. Inversion of A:T base pair into T:A base pair in the center of the binding site, which provides a mismatch selectively for DNG moiety, decreases the triplex stability by only 5-6 degrees C. Upon hybridization of DNG-Hoechst conjugates with the 30-mer ssDNA, the DNA.DNG-H duplex exhibited significant increase in the fluorescence emission due to the binding of the tethered Hoechst ligand in the generated DNA.DNG minor groove, and the duplex stability was enhanced by DeltaT(m) of 7 degrees C. The stability of (DNA)(2).DNG triplexes and DNA.DNG duplexes is independent of pH, whereas the stability of (DNA)(2).DNG-H triplexes decreases with increase in pH.     

Covalent Schiff base catalysis and turnover by a DNAzyme: a M2+ -independent AP-endonuclease mimic

A DNAzyme, synthetically modified with both primary amines and imidazoles, is found to act as a M2+ -independent AP lyase-endonuclease. In the course of the cleavage reaction, this DNAzyme forms a covalent Schiff base intermediate with an abasic site on a complementary oligodeoxyribonucleotide. This intermediate, which is inferred from NaCNBH3 trapping as well as cyanide inhibition, does not evidently accumulate because the second step, dehydrophosphorylative elimination, is fast compared to Schiff base formation. The 5'-product that remains linked to the catalyst hydrolyzes slowly to regenerate free catalyst. The use of duly modified DNAzymes to perform Schiff base catalysis demonstrates the value of modified nucleotides for enhancing the catalytic repertoire of nucleic acids. This work suggests that DNAzymes will be capable of catalyzing aldol condensation reactions.     

True molar surface energy and alignment of surface molecules

By use of data for surface tension, for the first time a method is presented for calculating true molar surface properties of liquids: free energy, entropy, and enthalpy. These new data allow full comparison with other molar quantities, such as enthalpy and entropy of vaporization. All data are at the normal boiling point. There are differences in behavior between various classes of nonpolar compounds. Rare gases and tetrahydrides of Group 14 form a separate category. The results agree with the experimental findings that water and alcohol molecules are aligned with the -OH groups attached to the surface. The data indicate that hydrogen peroxide and 1,2-ethanediol also have one -OH group directed toward the surface and one directed out toward the vapor phase. Small straight-chain amines have some structure at the surface, but the larger ones behave like the corresponding alkanes. Very polar compounds, such as nitriles, nitro compounds, and aldehydes, have little or no increased degree of order of molecules at the surface. Except for hydrogen-bonded compounds, molecules at the surface have surroundings similar to those in the bulk liquid.     

Synthesis, structure, and dynamics of nickelacarboranes incorporating the [nido-7,9-C(2)B(9)H(11)](2)(-) ligand

The nickelacarboranes [NEt(4)][2-(eta(3)-C(3)H(4)R)-closo-2,1,7-NiC(2)B(9)H(11)] (R = H (1a), Ph (1b)) have been synthesized via reaction between [Na](2)[nido-7,9-C(2)B(9)H(11)] and [Ni(2)(micro-Br)(2)(eta(3)-C(3)H(4)R)(2)] in THF (THF = tetrahydrofuran), followed by addition of [NEt(4)]Cl. Protonation of 1a in the presence of a donor ligand L affords the complexes [2,2-L(2)-closo-2,1,7-NiC(2)B(9)H(11)] (L = CO (2), CNBu(t) (3)). Addition of PEt(3) (1 equiv) to 2 produces quantitative conversion to [2-CO-2-PEt(3)-closo-2,1,7-NiC(2)B(9)H(11)], 4. Species 2-4 exhibit in solution hindered rotation of the NiL(2) fragment with respect to the eta(5)-C(2)B(9) cage unit. Protonation of 1a in the presence of a diene affords the neutral complexes [2-(eta(2):eta(2)-diene)-closo-2,1,7-NiC(2)B(9)H(11)] (diene = C(5)Me(5)H (5), dcp (6), cod (7), nbd (8), chd (9), and cot (10a); dcp = dicyclopentadiene, cod = 1,5-cyclooctadiene, nbd = norbornadiene, chd = 1,3-cyclohexadiene, and cot = cyclooctatetraene). Variable temperature (1)H NMR experiments show that the [Ni(diene)] fragments are freely rotating even at 193 K. A small quantity of the di-cage species [2,2'-micro-(1,2:5,6-eta-3,4:7,8-eta-cot)-(closo-2,1,7-NiC(2)B(9)H(11))(2)] (10b) is formed as a coproduct in the synthesis of 10a. This species can be rationally synthesized by protonation of 1a and subsequent addition of 10a.     

Development of a new dimeric cyclophane ligand: application to enhanced diastereo- and enantioselectivity in the catalytic synthesis of beta-lactams

We detail the synthesis of a new C(2)-symmetric bis(cyclophane) ligand system that can be thought of as electronically analogous to binol, but which possesses the added "third dimension" of cyclophane chirality. The ligand synthesis involves a spontaneous (but unexpected) atropisomerization to the desired product. We have employed this ligand to form a metal complex that is an effective cocatalyst for the highly enantio- and diastereoselective catalytic asymmetric synthesis of a beta-lactam.