Collaborative study for the detection of toxic compounds in shellfish extracts using cell-based assays. Part I: screening strategy and pre-validation study with lipophilic marine toxins

Human poisoning due to consumption of seafood contaminated with phycotoxins is a worldwide problem, and routine monitoring programs have been implemented in various countries to protect human consumers. Following successive episodes of unexplained shellfish toxicity since 2005 in the Arcachon Bay on the French Atlantic coast, a national research program was set up to investigate these atypical toxic events. Part of this program was devoted to fit-for-purpose cell-based assays (CBA) as complementary tools to collect toxicity data on atypical positive-mouse bioassay shellfish extracts. A collaborative study involving five laboratories was conducted. The responses of human hepatic (HepG2), human intestinal (Caco2), and mouse neuronal (Neuro2a) cell lines exposed to three known lipophilic phycotoxins-okadaic acid (OA), azaspiracid-1 (AZA1), and pectenotoxin-2 (PTX2)-were investigated. A screening strategy composed of standard operating procedures and a decision tree for dose-response modeling and assay validation were designed after a round of "trial-and-error" process. For each toxin, the shape of the concentration-response curves and the IC(50) values were determined on the three cell lines. Whereas OA induced a similar response irrespective of the cell line (complete sigmoid), PTX2 was shown to be less toxic. AZA1 induced cytotoxicity only on HepG2 and Neuro2a, but not on Caco2. Intra- and inter-laboratory coefficients of variation of cell responses were large, with mean values ranging from 35 to 54 % and from 37 to 48 %, respectively. Investigating the responses of the selected cell lines to well-known toxins is the first step supporting the use of CBA among the panel of methods for characterizing atypical shellfish toxicity. Considering these successful results, the CBA strategy will be further applied to extracts of negative, spiked, and naturally contaminated shellfish tissues.     

Electrogenerated chemiluminescence of poly[(2,2′-bipyridyl)(4-(2-pyrrol-1-ylethyl)-4′-methyl-2,2′-bipyridyl)2]ruthenium (II) film

Elelctrogenerated chemiluminescence (ECL) of electropolymerized films based on [(2,2′-bipyridyl)(4-(2-pyrrol-1-ylethyl)-4′-methyl-2,2′-bipyridyl)₂]ruthenium (II) was firstly investigated in both organic and aqueous solution. The ECL behaviors have been explained by two typical mechanisms, namely, redox-cycling type and oxidative-reduction type. For the former, no co-reactant was required and for the latter, tripropylamine (TPA) and (NH₄)₂C₂O₄ were selected as co-reactants in the organic and aqueous system, respectively.     

Circular dichroism signatures of features simultaneously present in structured guanine-rich oligonucleotides: a combined spectroscopic and electrophoretic approach

In order to identify possible signatures of the most typical structures adopted by guanine-rich oligonucleotides, we submitted them to the crossed fire of circular dichroism (CD) and electrophoresis. These signatures show up in the circular dichroism spectra even when simultaneously present within the same molecule. Guanine-rich oligonucleotides, when structured, manifest themselves by CD contributions around 260 or 295 nm. For instance, positive bands at 264 nm and 295 nm, respectively, signal the parallel and antiparallel guanine quartets, while a positive band around 261 nm may indicate the presence of a (parallel?) Hoogsteen duplex. A positive band at 264 nm may also reflect the presence of rigidly and unusually oriented GpT and TpG steps within loops. The signatures are additive with those of other structural features of the same molecule, such as hairpins or Watson-Crick duplexes, whose bands are observed at 280 nm.     

A silicon-position dependent 6-endo-trig cyclization during Tsuji–Trost alkylation

Two silylated cyclohexenes products have been prepared by using a Tsuji–Trost palladium-catalyzed cyclization. It involves the generation of a cationic π-allylic palladium complex bearing a triethylsilyl group on C-3, which cyclizes via a 6-endo-trig process to afford the cyclohexene derivatives. It is also demonstrated that the position of the silyl group on the starting allylic substrate strongly influenced the reaction. It could favor either the production of the expected cyclohexenyl ring or a diene by an elimination that occurs on the silyl-substituted C-2 π-allylic palladium complex.     

Controlling Photons in a Box and Exploring the Quantum to Classical Boundary (Nobel Lecture)

Microwave photons trapped in a superconducting cavity constitute an ideal system to realize some of the thought experiments imagined by the founding fathers of quantum physics. The interaction of these trapped photons with Rydberg atoms crossing the cavity illustrates fundamental aspects of measurement theory. The experiments performed with this “photon box” at Ecole Normale Supérieure (ENS) belong to the domain of quantum optics called “Cavity Quantum Electrodynamics”. We have realized the non‐destructive counting of photons, the recording of field quantum jumps, the preparation and reconstruction of “Schrödinger cat” states of radiation and the study of their decoherence, which provides a striking illustration of the transition from the quantum to the classical world. These experiments have also led to the demonstration of basic steps in quantum information processing, including the deterministic entanglement of atoms and the realization of quantum gates using atoms and photons as quantum bits. This lecture starts by an introduction stressing the connection between the ENS photon box and the ion trap experiments of David Wineland, whose accompanying lecture recalls his own contribution to the field of single particle control. I give then a personal account of the early days of Cavity Quantum Electrodynamics before describing the main experiments performed at ENS during the last twenty years and concluding by a discussion comparing our work to other researches dealing with the control of single quantum particles.     

Investigation of a stereoselective co-mediated rearrangement reaction

A stereocontrolled approach to alpha-alkyl beta-alkynyl cyclohexanones is reported through a Lewis acid mediated rearrangement reaction of enol ethers bearing an Co-alkyne moiety. The reaction proceeds with high levels of stereoselectivity in the presence of Ti- and B-Lewis acids to provide a range of alpha,beta-disubstituted cyclohexanones in high yield although the products are prone to epimerization at the alpha-position in the presence of the B-promoter system. The potential for an enantioselective variant of this process is outlined, and a rationale for the observed stereochemical trends and detailed structural analyses of the ketone products are described.     

Investigation of the interaction of carbofuran and DNA by voltammetry and fluorescence with the aid of chemometrics

<正>The interactions of carbofuran and DNA were studied using voltammetry and fluorescence spectroscopy.The formation of carbofuran-DNA makes the current peak of DNA decreased by voltammetry method.The binding number(n) and constant(K_a) for complex carbofuran-DNA were calculated to be 1.06±0.04 and 0.11±0.03mol~(-1) L,respectively by fluorescence measurement.Chemometrics approach,such as singular value decomposition(SVD) was used to evaluate the number of spectral species in the drug-DNA binding process.And the pure spectra and concentration profiles in the kinetic system were clearly deduced by multivariate curve resolution alternating least squares(MCR-ALS) with the initial estimates by evolving factor analysis(EFA).     

Analysis of basic compounds at high pH values by reversed-phase liquid chromatography

Reversed phase high performance liquid chromatography (RPLC) is currently the method of choice for the analysis of basic compounds. However, with traditional silica materials, secondary interactions between the analyte and residual silanols produce peak tailing which can negatively affect resolution, sensitivity, and reproducibility. In order to reduce these secondary interactions, which comprise ion exchange, hydrogen bonding, and London forces interactions, chromatographic analyses can be carried out at low or high pH values where silanol groups and basic compounds are mostly uncharged. The chromatographic behaviour of a particular bidentate stationary phase, Zorbax Extend C18, was studied with a set of basic and neutral compounds. Thanks to a higher chemical stability than traditional silica based supports, analyses were carried out with a high pH mobile phase, which represents a good alternative to the acidic mobile phases generally used to reduce ion exchange interactions. The performance of this bidentate stationary phase was also compared with that of other supports and it was proved that it is advantageous to work with high pH mobile phases when analyzing basic compounds.     

Synthesis, nuclear, and magnetic structures and magnetic properties of [Mn3(OH)2(SO4)2(H2O)2

[Mn(3)(OH)(2)(SO(4))(2)(H(2)O)(2)] and its deuterated analogue were synthesized by a hydrothermal technique and characterized by differential thermal analysis, thermogravimetric analysis, and IR spectroscopy. Its nuclear structure, determined by single-crystal X-ray analysis and Rietveld analysis of neutron powder-diffraction data, consists of a 3D network of chains of edge-sharing Mn(1)O(6), running along the c axis, connected by the apices of Mn(2)O(6) and SO(4) units. It is isostructural to the nickel analogue. Determination of the magnetic structure and measurements of magnetization and heat capacity indicate the coexistence of both magnetic long-range ordering (LRO) and short-range ordering (SRO) below a Néel temperature of 26 K, while the SRO is retained at higher temperatures. The moments of the two independent Mn atoms lie in the bc plane, and that of Mn(1) rotates continuously by 54 degrees towards the c axis on decreasing the temperature from 25 to 1.4 K. While the SRO may be associated with frustration of the moments within a Mn(3) trimer, the LRO is achieved by antiparallel alignment of the four symmetry-related trimers within the magnetic unit cell. A spin-flop field, measured by dc and ac magnetization on a SQUID, is observed at 15 kOe.     

2,2,5,5-tetramethylpyrrolidin-3-one-1-sulfinyl group for 5'-hydroxyl protection of deoxyribonucleoside phosphoramidites in the solid-phase preparation of DNA oligonucleotides

Several nitrogen-sulfur reagents have been investigated as potential 5'-hydroxyl protecting groups for deoxyribonucleoside phosphoramidites to improve the synthesis of oligonucleotides on glass microarrays. Out of the nitrogen-sulfur-based protecting groups so far investigated, the 2,2,5,5-tetramethylpyrrolidin-3-one-1-sulfinyl group exhibited near optimal properties for 5'-hydroxyl protection by virtue of the mildness of its deprotection conditions. Specifically, the iterative cleavage of a terminal 5'-sulfamidite group in the synthesis of 5'-d(ATCCGTAGCCAAGGTCATGT) on controlled-pore glass is efficiently accomplished by treatment with iodine in the presence of an acidic salt. Hydrolysis of the oligonucleotide to its 2'-deoxyribonucleosides upon exposure to snake venom phosphodiesterase and bacterial alkaline phosphatase did not reveal the formation of any nucleobase adducts or other modifications. These findings indicate that the 2,2,5,5-tetramethylpyrrolidin-3-one-1-sulfinyl group for 5'-hydroxyl protection of phosphoramidites, such as 10a-d, may lead to the production of oligonucleotide microarrays exhibiting enhanced specificity and sensitivity in the detection of nucleic acid targets.