Oxygenolysis of flavonoid compounds: DFT description of the mechanism for quercetin.

Flavonoids are naturally occurring phenol derivatives present in substantial amounts in a large variety of plants, fruits and vegetables daily eaten by humans. Most of these compounds exhibit several interesting biological activities, such as antiradical and antioxidant actions. Indeed, by complexation with specific enzymes, flavonoids are notably liable to metabolize molecular dioxygen. On the basis of experimental results describing oxygenolysis of the flavonoid quercetin, activated by the enzyme quercetin 2,3-dioxygenase (2,3-QD),ur attention has focused on the role of metal center in the activation of the substrate quercetin. Thus, in the present study, by means of DFT calculations at the B3LYP/ 6-31(+)G* level on model molecular systems, we describe different mechanisms for dioxygen metabolization by quercetin. Stationary points are described, and energetic and structural analyses along the reaction paths are reported. Our calculations show that the copper cation must act as an oxidant towards the substrate and that the reaction proceeds through a 1,3-cycloaddition.     

A case of oligomerization on attempted chlorination of an α-hydroxy acetal with the triphenylphosphine tetrachloromethane reagent

Treatment of methyl 3,5-dideoxy-β-$\text{D}$-$\text{erythro}$-pentofuranoside $\text{8}$ with the Ph₃P-CCl₄ reagent gave none of the expected 2-chloro derivative but a mixture of l→2 linked oligosaccharides, $\text{9}$, $\text{10}$ with some higher homologues, terminated by αa 2-chloro-2,3,5-trideoxy-α-$\text{D}$-$\text{threo}$-pentofuranosyl unit at the non reducing end.     

2,2,5,5-tetramethylpyrrolidin-3-one-1-sulfinyl group for 5'-hydroxyl protection of deoxyribonucleoside phosphoramidites in the solid-phase preparation of DNA oligonucleotides

Several nitrogen-sulfur reagents have been investigated as potential 5'-hydroxyl protecting groups for deoxyribonucleoside phosphoramidites to improve the synthesis of oligonucleotides on glass microarrays. Out of the nitrogen-sulfur-based protecting groups so far investigated, the 2,2,5,5-tetramethylpyrrolidin-3-one-1-sulfinyl group exhibited near optimal properties for 5'-hydroxyl protection by virtue of the mildness of its deprotection conditions. Specifically, the iterative cleavage of a terminal 5'-sulfamidite group in the synthesis of 5'-d(ATCCGTAGCCAAGGTCATGT) on controlled-pore glass is efficiently accomplished by treatment with iodine in the presence of an acidic salt. Hydrolysis of the oligonucleotide to its 2'-deoxyribonucleosides upon exposure to snake venom phosphodiesterase and bacterial alkaline phosphatase did not reveal the formation of any nucleobase adducts or other modifications. These findings indicate that the 2,2,5,5-tetramethylpyrrolidin-3-one-1-sulfinyl group for 5'-hydroxyl protection of phosphoramidites, such as 10a-d, may lead to the production of oligonucleotide microarrays exhibiting enhanced specificity and sensitivity in the detection of nucleic acid targets.     

Targeting of Single‐Stranded Oligonucleotides through Metal‐Induced Cyclization of Short Complementary Strands

A new strategy to cyclize short synthetic oligonucleotides on DNA or RNA target strands is described. The approach is based on metal‐templated cyclization of short synthetic oligonucleotides conjugated with two chelating 2,2′ : 6′,2′′‐terpyridine (Tpy) moieties at their 3′‐ and 5′‐ends. Cyclization after metal addition (Zn²⁺, Fe²⁺) was demonstrated by means of thermal‐denaturation experiments, MALDI‐Q‐TOF‐MS, and gel electrophoresis (PAGE). 1D‐ and 2D‐NMR Experiments were performed to analyze the association of complementary strands after metal‐mediated cyclization. Our protocol allows the efficient circularization of synthetic oligonucleotides. Thereby, the hybridization on a complementary strand was more efficient with an RNA target strand and a 2′‐O‐methylated circularized oligomer.     

Plastic deformation and performance of engineering polymer materials

The plastic deformation mechanism operating in polymer glasses is analyzed. The whole process consists of two main stages: nucleation of special shear defects, called PSTs (plastic shear transformations), and their disappearance. The important feature of plastic deformation of glasses is the storage of a large amount of internal energy ΔU_def upon straining. Such energy storage is the critical issue for mechanical performance of polymeric material: if the amount of stored energy is high, the appearance of macroscopic failure is very probable while glassy materials collecting a small amount of stored deformation energy are quite ductile. It is proposed that the rate of disappearance of PSTs is a key factor in dissipation of stored deformation energy. A parameter describing the dissipation ability of material upon deformation is introduced.     

Novel RPLC stationary phases for lipophilicity measurement: solvatochromic analysis of retention mechanisms for neutral and basic compounds

An RPLC was developed to rapidly determine lipophilicity of neutral and basic compounds using three base deactivated RPLC stationary phases particularly designed for the analysis of basic compounds, namely, Supelcosil ABZ(+)Plus, Discovery RP Amide C16, and Zorbax Extend C18. The work consisted of three sets of experiments. In the first log kw values of neutral compounds were extrapolated using hydroorganic mobile phases at different compositions. Good correlation between log kw and log Poct indicated that the method was appropriate for these supports, without adding a silanol masking agent. In the second set of experiments, isocratic log k values of neutral and basic compounds were measured with three different mobile phases. The best estimation of lipophilicity was obtained for neutral and basic compounds when the secondary interactions were strongly reduced (i. e., when basic compounds were under their neutral form). In the third set of experiments, isocratic retention factors of basic compounds (in their neutral form) were measured with a high-pH mobile phase, on a chemically stable support (Zorbax Extend C18). Under these chromatographic conditions, correlation between the isocratic retention factors and log Poct (log D10.5) for basic compounds was similar to that for neutral compounds.     

Development of cross-linked polystyrene-supported chiral amines featuring a fluorinated linker for gel-phase 19F NMR spectrometry monitoring of reactions

Ten cross-linked polystyrene-supported, protected chiral amines featuring both a spacer, comprising from 5 to 15 atoms, and a fluorinated linker have been successfully prepared. The development of the monitoring technique by gel-phase 19F NMR spectrometry on cross-linked polystyrene derivatives proved to be of high value in four steps of the process, as shown by the comparison of data gathered from both a classic NMR spectrometer and elemental analysis. Gel-phase 19F NMR spectrometry, thus, constitutes a useful technique that complements IR and 13C NMR spectrometries for the qualitative monitoring of reactions. In addition, quantitative determination of the conversion in a given transformation is possible, provided that 19F chemical shifts of the substrate and the product be different enough (Deltadelta>base width), as illustrated by the Mitsunobu coupling process (16-->17). The technique is nondestructive, and the samples used to monitor the reactions may be returned to the reaction medium. Deprotection of the above amines was achieved and furnished eight of the final resins in good to acceptable purity for future applications.     

Synthesis of homoceramides, novel ceramide analogues, and their lack of effect on the growth of hippocampal neurons

The synthesis of a new series of D-erythro-homoceramide analogues is described. Several synthetic approaches were investigated. Homoceramides can be successfully synthesized from L-homoserine as chiral building block and a protected Weinreb-amide as a key intermediate. The synthesis of short-chain analogues with a heptyl side chain, as well as with a phenyl residue in the sphingoid part (instead of the naturally occurring tridecyl side chain), was effected. The homoceramides 15-17 and 24 were investigated for their potential to reverse the inhibitory effect of fumonisin B(1) on axonal growth. Unfortunately, none of the tested compounds showed any biological activity due to their lack of metabolism to glucosylhomoceramide.