Oxygenolysis of flavonoid compounds: DFT description of the mechanism for quercetin.

Flavonoids are naturally occurring phenol derivatives present in substantial amounts in a large variety of plants, fruits and vegetables daily eaten by humans. Most of these compounds exhibit several interesting biological activities, such as antiradical and antioxidant actions. Indeed, by complexation with specific enzymes, flavonoids are notably liable to metabolize molecular dioxygen. On the basis of experimental results describing oxygenolysis of the flavonoid quercetin, activated by the enzyme quercetin 2,3-dioxygenase (2,3-QD),ur attention has focused on the role of metal center in the activation of the substrate quercetin. Thus, in the present study, by means of DFT calculations at the B3LYP/ 6-31(+)G* level on model molecular systems, we describe different mechanisms for dioxygen metabolization by quercetin. Stationary points are described, and energetic and structural analyses along the reaction paths are reported. Our calculations show that the copper cation must act as an oxidant towards the substrate and that the reaction proceeds through a 1,3-cycloaddition.     

A case of oligomerization on attempted chlorination of an α-hydroxy acetal with the triphenylphosphine tetrachloromethane reagent

Treatment of methyl 3,5-dideoxy-β-$\text{D}$-$\text{erythro}$-pentofuranoside $\text{8}$ with the Ph₃P-CCl₄ reagent gave none of the expected 2-chloro derivative but a mixture of l→2 linked oligosaccharides, $\text{9}$, $\text{10}$ with some higher homologues, terminated by αa 2-chloro-2,3,5-trideoxy-α-$\text{D}$-$\text{threo}$-pentofuranosyl unit at the non reducing end.     

2,2,5,5-tetramethylpyrrolidin-3-one-1-sulfinyl group for 5'-hydroxyl protection of deoxyribonucleoside phosphoramidites in the solid-phase preparation of DNA oligonucleotides

Several nitrogen-sulfur reagents have been investigated as potential 5'-hydroxyl protecting groups for deoxyribonucleoside phosphoramidites to improve the synthesis of oligonucleotides on glass microarrays. Out of the nitrogen-sulfur-based protecting groups so far investigated, the 2,2,5,5-tetramethylpyrrolidin-3-one-1-sulfinyl group exhibited near optimal properties for 5'-hydroxyl protection by virtue of the mildness of its deprotection conditions. Specifically, the iterative cleavage of a terminal 5'-sulfamidite group in the synthesis of 5'-d(ATCCGTAGCCAAGGTCATGT) on controlled-pore glass is efficiently accomplished by treatment with iodine in the presence of an acidic salt. Hydrolysis of the oligonucleotide to its 2'-deoxyribonucleosides upon exposure to snake venom phosphodiesterase and bacterial alkaline phosphatase did not reveal the formation of any nucleobase adducts or other modifications. These findings indicate that the 2,2,5,5-tetramethylpyrrolidin-3-one-1-sulfinyl group for 5'-hydroxyl protection of phosphoramidites, such as 10a-d, may lead to the production of oligonucleotide microarrays exhibiting enhanced specificity and sensitivity in the detection of nucleic acid targets.     

Development of cross-linked polystyrene-supported chiral amines featuring a fluorinated linker for gel-phase 19F NMR spectrometry monitoring of reactions

Ten cross-linked polystyrene-supported, protected chiral amines featuring both a spacer, comprising from 5 to 15 atoms, and a fluorinated linker have been successfully prepared. The development of the monitoring technique by gel-phase 19F NMR spectrometry on cross-linked polystyrene derivatives proved to be of high value in four steps of the process, as shown by the comparison of data gathered from both a classic NMR spectrometer and elemental analysis. Gel-phase 19F NMR spectrometry, thus, constitutes a useful technique that complements IR and 13C NMR spectrometries for the qualitative monitoring of reactions. In addition, quantitative determination of the conversion in a given transformation is possible, provided that 19F chemical shifts of the substrate and the product be different enough (Deltadelta>base width), as illustrated by the Mitsunobu coupling process (16-->17). The technique is nondestructive, and the samples used to monitor the reactions may be returned to the reaction medium. Deprotection of the above amines was achieved and furnished eight of the final resins in good to acceptable purity for future applications.     

Synthesis of homoceramides, novel ceramide analogues, and their lack of effect on the growth of hippocampal neurons

The synthesis of a new series of D-erythro-homoceramide analogues is described. Several synthetic approaches were investigated. Homoceramides can be successfully synthesized from L-homoserine as chiral building block and a protected Weinreb-amide as a key intermediate. The synthesis of short-chain analogues with a heptyl side chain, as well as with a phenyl residue in the sphingoid part (instead of the naturally occurring tridecyl side chain), was effected. The homoceramides 15-17 and 24 were investigated for their potential to reverse the inhibitory effect of fumonisin B(1) on axonal growth. Unfortunately, none of the tested compounds showed any biological activity due to their lack of metabolism to glucosylhomoceramide.     

Measurements of Temperatures and Electron Number Density in an Argon–Nitrogen Plasma Jet Generated by a dc Torch-Operation Close to Supersonic Threshold

An investigation of the plasma jet generated by a dc argon–nitrogen plasma torch, operated in association with a controlled-pressure chamber, is presented. The purpose of this article is to describe a study of the properties of a subsonic plasma jet under such operating conditions, when its transition to supersonic flow regime is nearly complete. The goal is that of performing plasma diagnostics not only in the initial region of the jet but also in the downstream region where the plasma emission is weak. For this purpose two different diagnostic methods are used. The first approach is based on non-intrusive optical emission spectroscopy, which yields both excitation and rotational temperatures as well as electron number density fields. The zone investigated by this method extends from the torch exit to about 10 nozzle diameters downstream. The second approach consisted of the use of the intrusive enthalpy probe technique for the measurement of the plasma gas temperature, mainly in the tail region of the plasma jet. In the present work, the effects of axial and radial distances across the jet, on the temperature and electron density profiles are discussed for subsonic flow conditions. Interesting features revealed are the data shown for the various diagnostic methods, which either disagree or overlap with each other. Finally, our results show the need for involving non-equilibrium models for the argon–nitrogen plasma due to the presence of significant differences between the temperatures of light and heavy particles.     

Circular dichroism signatures of features simultaneously present in structured guanine-rich oligonucleotides: a combined spectroscopic and electrophoretic approach

In order to identify possible signatures of the most typical structures adopted by guanine-rich oligonucleotides, we submitted them to the crossed fire of circular dichroism (CD) and electrophoresis. These signatures show up in the circular dichroism spectra even when simultaneously present within the same molecule. Guanine-rich oligonucleotides, when structured, manifest themselves by CD contributions around 260 or 295 nm. For instance, positive bands at 264 nm and 295 nm, respectively, signal the parallel and antiparallel guanine quartets, while a positive band around 261 nm may indicate the presence of a (parallel?) Hoogsteen duplex. A positive band at 264 nm may also reflect the presence of rigidly and unusually oriented GpT and TpG steps within loops. The signatures are additive with those of other structural features of the same molecule, such as hairpins or Watson-Crick duplexes, whose bands are observed at 280 nm.     

Synthesis of a versatile (S)-3-(hydroxymethyl)butane-1,2,4-triol building block and its application for the stereoselective synthesis of N-homoceramides

[structures: see text] A versatile (S)-3-(hydroxymethyl)butane-1,2,4-triol building block has been synthesized starting from D-isoascorbic acid, a common food preservative. The key transformation in this approach was the introduction of branching through a high yield and fully regioselective epoxide opening. This flexible synthon has been elaborated to a new class of (dihydro-)N-homo(phyto)ceramides.     

An efficient reagent for the phosphorylation of deoxyribonucleosides, DNA oligonucleotides, and their thermolytic analogues

[reaction: see text] The phosphoramidite 11 was prepared in three steps from methyl 2-mercaptoacetate and demonstrated efficiency in the synthesis of conventional 5'-/3'-phosphate/thiophosphate monoester derivatives of 2'-deoxyribonucleosides and DNA oligonucleotides. Moreover, the use of 11 has enabled the preparation of the dinucleoside phosphorothioate analogue 26 in high yields (>95%) with minimal cleavage (<2%) of the thermolytic thiophosphate protecting group.