Fullerohelicates: a new class of fullerene-containing supermolecules

A multicomponent array made of a bis-copper(I) helicate core and two peripheral fullerene subunits has been prepared and electron transfer from the photoexcited Cu(I)-complexed unit to C60 occurs.     

Structure‐Dependent Photoinduced Electron Transfer in Fullerodendrimers with Light‐Harvesting Oligophenylenevinylene Terminals

Oligophenylenevinylene (OPV)‐terminated phenylenevinylene dendrons G1 – G4 with one, two, four, and eight “side‐arms”, respectively, were prepared and attached to C₆₀ by a 1,3‐dipolar cycloaddition of azomethine ylides generated in situ from dendritic aldehydes and N‐methylglycine. The relative electronic absorption of the OPV moiety increases progressively along the fullerodendrimer family C₆₀G1 – C₆₀G4 , reaching a 99:1 ratio for C₆₀G4 (antenna effect). UV/Vis and near‐IR luminescence and transient absorption spectroscopy was used to elucidate photoinduced energy and electron transfer in C₆₀G1 – C₆₀G4 as a function of OPV moiety size and solvent polarity (toluene, dichloromethane, benzonitrile), taking into account the fact that the free‐energy change for electron transfer is the same along the series owing to the invariability of the donor–acceptor couple. Regardless of solvent, all the fullerodendrimers exhibit ultrafast OPV→C₆₀ singlet energy transfer. In CH₂Cl₂, the OPV→C₆₀ electron transfer from the lowest fullerene singlet level (¹C₆₀*) is slightly exergonic (ΔG_CS≈0.07 eV), but is observed, to an increasing extent, only in the largest systems C₆₀G2 – C₆₀G4 with lower activation barriers for electron transfer. This effect has been related to a decrease of the reorganization energy upon enlargement of the molecular architecture. Structural factors are also at the origin of an unprecedented OPV→C₆₀ electron transfer observed for C₆₀G3 and C₆₀G4 in apolar toluene, whereas in benzonitrile, electron transfer occurs in all cases. Monitoring of the lowest fullerene triplet state by sensitized singlet oxygen luminescence and transient absorption spectroscopy shows that this level is populated through intersystem crossing and is not involved in photoinduced electron transfer.     

Dirac's aether in relativistic quantum mechanics

The introduction by Dirac of a new aether model based on a stochastic covariant distribution of subquantum motions (corresponding to a vacuum state alive with fluctuations and randomness) is discussed with respect to the present experimental and theoretical discussion of nonlocality in EPR situations. It is shown (1) that one can deduce the de Broglie waves as real collective Markov processes on the top of Dirac's aether; (2) that the quantum potential associated with this aether's modification, by the presence of EPR photon pairs, yields a relativistic causal action at a distance which interprets the superluminal correlations recently established by Aspect et al.; (3) that the existence of the Einstein-de Broglie photon model (deduced from Dirac's aether) implies experimental predictions which conflict with the Copenhagen interpretation in certain specific testable interference experiments.     

Separation of capsular polysaccharide K4 and defructosylated K4 by high-performance capillary electrophoresis

A rapid, highly sensitive and reproducible high-performance capillary electrophoresis (HPCE) method (electrokinetic chromatography with sodium dodecyl sulfate) is described for the determination of the polysaccharide from the uropathogenic Escherichia coli K4 bacteria (05:K4:H4) and its defructosylated product. The two polyanions, K4 and defructosylated K4, are separated and readily determined within 30 min on an uncoated fused-silica capillary using normal polarity at 20 kV and detection at 200 nm. A linear relationship was found for the two polysaccharides over a wide range of concentrations, from approximately 30 ng (0.5 microg/microL) to 210 ng (3.5 microg/microL). The described method was used to evaluate the defructosylation process of K4 under drastic acid conditions.     

Exploring the Parallel G-Quadruplex Nucleic Acid World: A Spectroscopic and Computational Investigation on the Binding of the c-myc Oncogene NHE III1 Region by the Phytochemical Polydatin

Trans-polydatin (tPD), the 3-β-D-glucoside of the well-known nutraceutical trans-resveratrol, is a natural polyphenol with documented anti-cancer, anti-inflammatory, cardioprotective, and immunoregulatory effects. Considering the anticancer activity of tPD, in this work, we aimed to explore the binding properties of this natural compound with the G-quadruplex (G4) structure formed by the Pu22 [d(TGAGGGTGGGTAGGGTGGGTAA)] DNA sequence by exploiting CD spectroscopy and molecular docking simulations. Pu22 is a mutated and shorter analog of the G4-forming sequence known as Pu27 located in the promoter of the c-myc oncogene, whose overexpression triggers the metabolic changes responsible for cancer cells transformation. The binding of tPD with the parallel Pu22 G4 was confirmed by CD spectroscopy, which showed significant changes in the CD spectrum of the DNA and a slight thermal stabilization of the G4 structure. To gain a deeper insight into the structural features of the tPD-Pu22 complex, we performed an in silico molecular docking study, which indicated that the interaction of tPD with Pu22 G4 may involve partial end-stacking to the terminal G-quartet and H-bonding interactions between the sugar moiety of the ligand and deoxynucleotides not included in the G-tetrads. Finally, we compared the experimental CD profiles of Pu22 G4 with the corresponding theoretical output obtained using DichroCalc, a web-based server normally used for the prediction of proteins’ CD spectra starting from their “.pdb” file. The results indicated a good agreement between the predicted and the experimental CD spectra in terms of the spectral bands’ profile even if with a slight bathochromic shift in the positive band, suggesting the utility of this predictive tool for G4 DNA CD investigations.     

A corresponding states principle-based equation for the surface tension of Alkenes

This study presents a new formula for the surface tension prediction of alkenes. As a first step, an analysis of the available data of the experimental surface tension data for alkenes was performed. The experimental data were collected, after a careful literature survey, for the following pure fluids: propene, 1-hexene, 1-heptene, 1-octene, 1-decene, 1-tetradecene, and 1-pentadecene. Then, the experimental data were regressed with the most reliable semi-empirical correlating methods based on the corresponding state theory existing in the literature. As a final step, an analysis of the available data of the experimental surface tension data for alkenes was performed starting from the two recently proposed equations for the prediction of the surface tension of refrigerants based on the corresponding states principle. To minimize the deviation between the predicted data and the experimental data and to find the optimal equation coefficients for experimental data regression, a (μ + λ)-evolution strategy was adopted. The analysis showed that the equation that gave the best results for the prediction of the surface tension of alkenes was the one with a very limited number of parameters. The finally proposed equation is very simple and gives a noticeable improvement with respect to the existing equations. It is based on the corresponding state principle, containing the acentric factor, the critical temperature, and pressure.     

Symmetries of BLT-Sets

We do the tentative beginnings of a study of BLT-sets of generalised quadrangles via their symmetries. In particular, the study of whorls about a line leads us to hyperbolic reflections preserving a BLT-set of Q(4, q).