In-trees and plane embeddings of outerplanar graphs

A notion of anin-tree is introduced. It is then used to characterize and count plane embeddings of outerplanar graphs. In-trees have also been applied in the study of independent vertex covers of faces in outerplanar graphs.This research was partially supported by the grant RP.I.09, from the Institute of Informatics, University of Warsaw. Hospitality of the Institute of Datalogy, University of Copenhagen where this research has been completed is gratefully acknowledged.     

A fading effect in the X-ray diffraction contrast of dislocations

Fringes in the dislocation image in X-ray section topography are shown to fade away partially when unpolarized radiation is used. The fading effect is explained in terms of an analogy with the polarization beat in a wedge crystal. The polarization nature of the phenomenon is confirmed through numerical simulations of the contrast.Dedicated to Professor Dr. Ulrich Bonse on the occasion of his 60th birthday     

Platinum metallodrug-protein binding studies by capillary electrophoresis-inductively coupled plasma-mass spectrometry: characterization of interactions between Pt(II) complexes and human serum albumin

Characterizing how platinum metallocomplexes bind to human serum albumin (HSA) is essential in evaluating anticancer drug candidates. Using cisplatin as a reference complex, the application of capillary electrophoresis (CE) to reliably assess drug/HSA interactions was validated. Since this complex is small compared to the size of the protein, the binding response could only be recognized when applying CE coupled to a (platinum) metal-specific mode of detection, namely inductively coupled plasma-mass spectrometry (ICP-MS). This coupling allowed for confirmation of a specific affinity of cisplatin and novel Pt complexes to HSA, measurement of the kinetics of binding reactions, and determination of the number of drug molecules attached to the protein. As the cisplatin/HSA molar ratio increased, the reaction rate became faster with a maximum on the kinetic curve appearing at about 50 h of incubation at 20 times excess of cisplatin. The reaction was characterized as a pseudo-first order reaction with the rate constant k = 0.003 min(-1) at 37 degrees C. When incubated with a 20-fold excess of cisplatin, HSA bound up to 10 mol of Pt per mol of the protein. This is indicative for a strong metal-protein coordination occurring at several HSA sites other than the only protein cysteine residue. Structural analogs of cisplatin, bearing aminoalcohol ligands, showed comparable protein binding reactivity and stoichiometry but a common equilibrium was not reached even after one week of incubation. Also apparent was a two-step mechanism of the binding reaction. Results demonstrated the suitability of CE-ICP-MS as a rapid assay for high-throughput studying of drug/HSA interactions.     

Application of platinum gauze activated by hydrogen to the adsorption separation of silver traces and their determination by aas or spectrophotometry

A method ("electrosorption") has been developed for separation of silver from copper by its deposition through internal electrolysis with hydrogen adsorbed on a platinum surface. The silver can then be stripped and determined by atomic-absorption spectrometry or the dithizone method. The activation of the platinum surface with adsorbed hydrogen can be achieved either electrolytically or by passing hydrogen gas through the solution in which the platinum is immersed. The method of electrosorption has been successfully applied to determination of trace levels of silver in copper metal.     

Origin of organic gaseous products formed in the thermal decomposition of formates

The gaseous products of the thermal decomposition of formates have been investigated and compared with the products of formaldehyde and synthesis gas transformation under analogous conditions in the presence of the solids formed in the thermal decomposition of particular formates. It was found that formaldehyde transformation leads to organic compounds identical to those obtained in the thermal decomposition of the respective formates, while synthesis gas does not react under such conditions. This fact substantiates the hypothesis that formaldehyde is a precursor of the organic compounds identified in the thermal decomposition of formates. The nature of the organic componds obtained in the thermal decomposition of formates indicates that the formaldehyde formed in the initial stages is then transformed in the Cannizzaro or Tishchenko reactions.

---

Zusammenfassung Die gasförmigen Produkte der thermischen Zersetzung von Formiaten wurden untersucht und mit den Produkten verglichen, die bei der Umwandlung von Formaldehyd und Synthesegas unter analogen Bedingungen in Gegenwart von bei der thermischen Zersetzung von speziellen Formiaten gebildeten Feststoffen entstehen. Formaldehydumwandlungen führen zu organischen Verbindungen, die identisch mit denen sind, die bei der thermischen Zersetzung des betreffenden Formiats gebildet werden, während Synthesegas unter solchen Bedingungen nicht reagiert. Dies erhärtet die Hypothese, daß Formaldehyd eine Vorstufe der bei der thermischen Zersetzung von Formiaten identifizierten organischen Verbindungen ist. Die Natur der bei der thermischen Zersetzung von Formiaten auftretenden organischen Verbindungen weist darauf hin, daß das in den ersten Reaktionsschritten gebildete Formaldehyd nach der Cannizzaro-oder Tishchenko-Reaktion weiterreagiert.

---

, , . , i , . . , , . , , , .

     

Reibungsdämpfung durch Scheuerleisten: Ein praxisgerechtes Auslegungskonzept

Übersicht Die Fugen zusammengesetzter Bauteile sind einerseits für eine nachteilige Steifigkeitsminderung verantwortlich, tragen aber andererseits durch Reibungsvorgänge wesentlich zum Dämpfungsvermögen einer Konstruktion bei. Merkliche Reibungsdämpfung ohne gleichzeitigen Steifigkeitsverlust bewirken zusätzliche Fugen, die durch Anbringen sogenannter Scheuerleisten entstehen. Der Autor stellt ein Näherungsverfahren zur dämpfungsoptimalen Auslegung von Scheuerleisten vor. Ausgehend von der zu dämpfenden Schwingungsform liefert dieses Verfahren Kriterien für eine günstige Scheuerleistenanordnung, geeignete Leistenabmessungen und als wichtigstes Ergebnis eine dämpfungsoptimale Fugenpressung, die zu maximaler Energiedissipation führt. Schließlich kann das zu erwartende Dämpfungsmaß berechnet und damit das Ergebnis einer vorgesehenen Dämpfungsmaßnahme abgeschätzt werden.

---

Damping by friction ledges: a practical design concept

Summary On the one hand, mating surfaces of structures are responsible for a reduction of stiffness, on the other hand relative motion produces friction, which contributes considerably to the damping. Noticeable friction damping without simultaneous stiffness reduction can be achieved by adding further mating surfaces. Such interfaces are realized by fastening additional elements (e.g. beamlike) onto the structure. An analytic approximation method for these so-called friction ledges is described in this paper. Initiating from the mode shape to be damped the procedure yields criteria for the suitable positioning and design of the ledges. Most important of all is the damping optimized interface pressure, that leads to maximum energy dissipation. Finally, the expected damping rate can be computed, and therefore the result of the proposed measure assessed.

     

Quantum spheres

Spaces homogeneous under the action of the quantum SU(2) group are introduced and investigated. These spaces can be considered as noncommutative two-dimensional spheres of different radii. The geometry of the space built from those spheres makes possible one-particle dipole electric transitions with l=0.     

Structural assignment of organotin hydrides containing the oxazoline ligand

A series of triorganotin hydrides and diorganotin dihydrides containing the optically active 2-(4-isopropyl-2-oxazolinyl)-5-phenyl ligand have been characterized by means of the multinuclear low-temperature NMR investigations, the results of which are discussed. In the corresponding organotin hydrides values of the ¹J(¹H-^117/119Sn) couplings appeared to be temperature dependent, supporting an axial/equatorial position of the hydrogen attached to the tin.     

2,2,5,5-tetramethylpyrrolidin-3-one-1-sulfinyl group for 5'-hydroxyl protection of deoxyribonucleoside phosphoramidites in the solid-phase preparation of DNA oligonucleotides

Several nitrogen-sulfur reagents have been investigated as potential 5'-hydroxyl protecting groups for deoxyribonucleoside phosphoramidites to improve the synthesis of oligonucleotides on glass microarrays. Out of the nitrogen-sulfur-based protecting groups so far investigated, the 2,2,5,5-tetramethylpyrrolidin-3-one-1-sulfinyl group exhibited near optimal properties for 5'-hydroxyl protection by virtue of the mildness of its deprotection conditions. Specifically, the iterative cleavage of a terminal 5'-sulfamidite group in the synthesis of 5'-d(ATCCGTAGCCAAGGTCATGT) on controlled-pore glass is efficiently accomplished by treatment with iodine in the presence of an acidic salt. Hydrolysis of the oligonucleotide to its 2'-deoxyribonucleosides upon exposure to snake venom phosphodiesterase and bacterial alkaline phosphatase did not reveal the formation of any nucleobase adducts or other modifications. These findings indicate that the 2,2,5,5-tetramethylpyrrolidin-3-one-1-sulfinyl group for 5'-hydroxyl protection of phosphoramidites, such as 10a-d, may lead to the production of oligonucleotide microarrays exhibiting enhanced specificity and sensitivity in the detection of nucleic acid targets.