Numerical analysis of an explicit approximation scheme for the Landau-Lifshitz-Gilbert equation

The Landau-Lifshitz-Gilbert equation describes magnetic behavior in ferromagnetic materials. Construction of numerical strategies to approximate weak solutions for this equation is made difficult by its top order nonlinearity and nonconvex constraint. In this paper, we discuss necessary scaling of numerical parameters and provide a refined convergence result for the scheme first proposed by Alouges and Jaisson (2006). As an application, we numerically study discrete finite time blowup in two dimensions.

     

Characterizing Pressure‐Induced Uranium C?H Agostic Bonds

The diuranium(III) compound [UN′′₂]₂(μ‐η⁶:η⁶‐C₆H₆) (N′′=N(SiMe₃)₂) has been studied using variable, high‐pressure single‐crystal X‐ray crystallography, and density functional theory . In this compound, the low‐coordinate metal cations are coupled through π‐ and δ‐symmetric arene overlap and show close metal CH contacts with the flexible methyl CH groups of the sterically encumbered amido ligands. The metal–metal separation decreases with increasing pressure, but the most significant structural changes are to the close contacts between ligand CH bonds and the U centers. Although the interatomic distances are suggestive of agostic‐type interactions between the U and ligand peripheral CH groups, QTAIM (quantum theory of atoms‐in‐molecules) computational analysis suggests that there is no such interaction at ambient pressure. However, QTAIM and NBO analyses indicate that the interaction becomes agostic at 3.2 GPa.     

Evaluation of preprocessing steps to compensate for magnetic field distortions due to body movements in BOLD fMRI

Blood oxygenation level-dependent (BOLD) functional magnetic resonance imaging (fMRI) is currently the dominant technique for non-invasive investigation of brain functions. One of the challenges with BOLD fMRI, particularly at high fields, is compensation for the effects of spatiotemporally varying magnetic field inhomogeneities (ΔB₀) caused by normal subject respiration and, in some studies, movement of the subject during the scan to perform tasks related to the functional paradigm. The presence of ΔB₀ during data acquisition distorts reconstructed images and introduces extraneous fluctuations in the fMRI time series that decrease the BOLD contrast-to-noise ratio. Optimization of the fMRI data-processing pipeline to compensate for geometric distortions is of paramount importance to ensure high quality of fMRI data. To investigate ΔB₀ caused by subject movement, echo-planar imaging scans were collected with and without concurrent motion of a phantom arm. The phantom arm was constructed and moved by the experimenter to emulate forearm motions while subjects remained still and observed a visual stimulation paradigm. These data were then subjected to eight different combinations of preprocessing steps. The best preprocessing pipeline included navigator correction, a complex phase regressor and spatial smoothing. The synergy between navigator correction and phase regression reduced geometric distortions better than either step in isolation and preconditioned the data to make them more amenable to the benefits of spatial smoothing. The combination of these steps provided a 10% increase in t-statistics compared to only navigator correction and spatial smoothing and reduced the noise and false activations in regions where no legitimate effects would occur.     

Individual variation in the pup attraction call produced by female Australian fur seals during early lactation

Otariid seals (fur seals and sea lions) are colonial breeders with large numbers of females giving birth on land during a synchronous breeding period. Once pups are born, females alternate between feeding their young ashore and foraging at sea. Upon return, both mother and pup must relocate each other and it is thought to be primarily facilitated by vocal recognition. Vocalizations of thirteen female Australian fur seals (Arctocephalus pusillus doriferus) were recorded during the breeding seasons of December 2000 and 2001, when pups are aged from newborns to one month. The pup attraction call was examined to determine whether females produce individually distinct calls which could be used by pups as a basis for vocal recognition. Potential for individual coding, discriminant function analysis (DFA), and classification and regression tree analysis were used to determine which call features were important in separating individuals. Using the results from all three analyses: F0, MIN F and DUR were considered important in separating individuals. In 76% of cases, the PAC was classified to the correct caller, using DFA, suggesting that there is sufficient stereotypy within individual calls, and sufficient variation between them, to enable vocal recognition by pups of this species.     

Balanced Cayley graphs and balanced planar graphs

A balanced graph is a bipartite graph with no induced circuit of length . These graphs arise in integer linear programming. We focus on graph-algebraic properties of balanced graphs to prove a complete classification of balanced Cayley graphs on abelian groups. Moreover, in this paper, we prove that there is no cubic balanced planar graph. Finally, some remarkable conjectures for balanced regular graphs are also presented. The graphs in this paper are simple.     

Inert benzothiazole functionalised ruthenium(II) complexes; potential DNA hairpin binding agents

The two enantiomers of [Ru(bpy)2(bbtb)]2+{bpy = 2,2'-bipyridine; bbtb = 4,4'-bis(benzothiazol-2-yl)-2,2'-bipyridine} have been isolated and fully characterised. Both enantiomers have been shown to have a strong association with calf thymus DNA by UV/visible absorption, emission and CD spectroscopy, with the Lambda enantiomer having the greater affinity. The binding of both enantiomeric forms of [Ru(bpy)2(Me2bpy)]2+ and [Ru(bpy)2(bbtb)]2+{Me(2)bpy = 4,4'-dimethyl-2,2'-bipyridine} to a range of oligonucleotides, including an octadecanucleotide and an icosanucleotide which contain hairpin-sequences, have been studied using a fluorescent intercalator displacement (FID) assay. The complex [Ru(bpy)2(bbtb)]2+ exhibited an interesting association with hairpin oligonucleotides, again with the Lambda enantiomer binding more strongly. A (1)H NMR spectroscopic study of the binding of both enantiomers of [Ru(bpy)2(bbtb)]2+ to the icosanucleotide d(CACTGGTCTCTCTACCAGTG) was conducted. This sequence contains a seven-base-pair duplex stem and a six-base hairpin-loop. The investigation gave an indication of the relative binding of the complexes between the two different regions (duplex and secondary structure) of the oligonucleotide. The results suggest that both enantiomers bind at the hairpin, with the ruthenium centre located at the stem-loop interface. NOE studies indicate that one of the two benzothiazole substituents of the bbtb ligand projects into the loop-region. A simple model of the metal complex/oligonucleotide adduct was obtained by means of molecular modelling simulations. The results from this study suggest that benzothiazole complexes derived from inert polypyridine ruthenium(II) complexes could lead to the development of new fluorescent DNA hairpin binding agents.     

Chirally modified zeolites as reaction media: photochemistry of an achiral tropolone ether

[structure: see text] Zeolites modified with chiral inductors serve as media for performing chiral induction during photochemical reactions of organic molecules. The photochemical behavior of achiral tropolone ethyl phenyl ether illustrates this unique feature of a zeolite.     

Modulation of molecular and kinetic properties of enzymes upon immobilization

Pea seedling glutamate dehydrogenase(EC 1.4.1.2) and Jack bean urease (EC 3.5.1.5) were immobilized on aminoethyl cellulose by cross-linking in a two-step reaction with glutaral dehyde. Specific activities of the immobilized dehydrogenase and urease were about 14% and 87%, respectively, of the original material in free solution. Both immobilized enzymes show no appreciable change in their pH dependence, whereas a less efficient binding of the substrates is suggested by the increased apparent Michaelis constants (K_m app.). Sigmoid kinetics were observed for both enzymes when reactions were carried out in a packed bed. Diffusional effects are considered responsible for producing these anomalous kinetics. The implications of these perturbations in terms of the catalytic efficiency of the enzymes, as well as the practical problems involved in the analysis of the kinetic data, are discussed.     

ROMP-generated oligomeric sulfonyl chlorides as versatile soluble scavenging agents

[reaction: see text] A new method for homogeneous nucleophilic scavenging employing oligomeric sulfonyl chloride (OSC) reagents is described. The method utilizes OSC to rapidly scavenge a variety of amines that are present in excess. The OSC reagents are generated from ROM polymerization of 2-chlorosulfonyl-5-norbornene utilizing the second generation Grubbs catalyst to produce oligomers of varying size as stable, free-flowing powders. Following the scavenging event, these oligomers are precipitated with ethyl acetate leaving products in excellent yield and purity.